Incidental Mutation 'PIT4486001:Gsdma3'
ID556113
Institutional Source Beutler Lab
Gene Symbol Gsdma3
Ensembl Gene ENSMUSG00000064224
Gene Namegasdermin A3
SynonymsGsdm1l, Bsk, Rim3, Dfl, Rco2, Gsdm3, Fgn
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98626360-98638226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98638054 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 454 (K454E)
Ref Sequence ENSEMBL: ENSMUSP00000073022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073295] [ENSMUST00000107508]
Predicted Effect unknown
Transcript: ENSMUST00000073295
AA Change: K454E
SMART Domains Protein: ENSMUSP00000073022
Gene: ENSMUSG00000064224
AA Change: K454E

DomainStartEndE-ValueType
Pfam:Gasdermin 3 430 1.4e-132 PFAM
low complexity region 438 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107508
AA Change: K445E
SMART Domains Protein: ENSMUSP00000103132
Gene: ENSMUSG00000064224
AA Change: K445E

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 9.5e-134 PFAM
low complexity region 429 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Gsdma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Gsdma3 APN 11 98637572 missense probably damaging 0.97
IGL01375:Gsdma3 APN 11 98629941 critical splice donor site probably null
IGL01721:Gsdma3 APN 11 98637956 missense possibly damaging 0.95
IGL02179:Gsdma3 APN 11 98635271 missense possibly damaging 0.88
IGL02612:Gsdma3 APN 11 98635881 missense probably damaging 0.99
IGL02866:Gsdma3 APN 11 98629759 missense possibly damaging 0.88
IGL02970:Gsdma3 APN 11 98632993 missense probably benign 0.01
Michelin UTSW 11 98637573 missense probably damaging 0.98
Mr_magoo UTSW 11 98635919 missense probably damaging 1.00
R0408:Gsdma3 UTSW 11 98635338 missense probably benign 0.41
R0539:Gsdma3 UTSW 11 98635919 missense probably damaging 1.00
R0675:Gsdma3 UTSW 11 98631191 missense probably benign 0.03
R1329:Gsdma3 UTSW 11 98632392 missense probably damaging 1.00
R1759:Gsdma3 UTSW 11 98635245 missense possibly damaging 0.93
R1812:Gsdma3 UTSW 11 98632393 missense probably damaging 0.99
R1838:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R1839:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R2287:Gsdma3 UTSW 11 98638004 missense possibly damaging 0.83
R4883:Gsdma3 UTSW 11 98629567 critical splice donor site probably null
R6767:Gsdma3 UTSW 11 98637884 missense possibly damaging 0.93
R7053:Gsdma3 UTSW 11 98629795 missense possibly damaging 0.75
R7733:Gsdma3 UTSW 11 98635215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTTGGAGCAGAACTTCCTG -3'
(R):5'- ACTTCAGGATTTAAGCATCAGGAG -3'

Sequencing Primer
(F):5'- CCTGCAAGATAAAGAGGGTGTTTTCC -3'
(R):5'- CATCAGGAGATGGGCTTAGTG -3'
Posted On2019-06-07