Incidental Mutation 'PIT4486001:Rara'
ID556114
Institutional Source Beutler Lab
Gene Symbol Rara
Ensembl Gene ENSMUSG00000037992
Gene Nameretinoic acid receptor, alpha
SynonymsRAR alpha 1, RARalpha1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4486001 (G1)
Quality Score138.008
Status Not validated
Chromosome11
Chromosomal Location98927818-98974942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98973495 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 416 (N416S)
Ref Sequence ENSEMBL: ENSMUSP00000069744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107473] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068133
AA Change: N416S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: N416S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107473
AA Change: N413S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103097
Gene: ENSMUSG00000037992
AA Change: N413S

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
ZnF_C4 82 153 7.53e-40 SMART
HOLI 227 385 1.22e-34 SMART
low complexity region 422 433 N/A INTRINSIC
low complexity region 436 459 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107474
AA Change: N416S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: N416S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107475
AA Change: N416S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: N416S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164748
AA Change: N416S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: N416S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Rara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Rara APN 11 98968166 missense probably benign 0.00
IGL01155:Rara APN 11 98968184 missense possibly damaging 0.92
IGL02141:Rara APN 11 98968081 missense probably damaging 1.00
IGL03194:Rara APN 11 98971664 missense possibly damaging 0.96
R0626:Rara UTSW 11 98971580 critical splice acceptor site probably null
R1973:Rara UTSW 11 98971670 missense possibly damaging 0.91
R3975:Rara UTSW 11 98970569 missense probably damaging 1.00
R4357:Rara UTSW 11 98968111 missense probably damaging 0.98
R5102:Rara UTSW 11 98966359 missense possibly damaging 0.80
R5147:Rara UTSW 11 98950724 missense probably benign 0.35
R5381:Rara UTSW 11 98971584 missense possibly damaging 0.93
R5570:Rara UTSW 11 98972652 missense probably damaging 1.00
R5861:Rara UTSW 11 98968161 nonsense probably null
R6273:Rara UTSW 11 98970222 missense probably benign 0.00
R6404:Rara UTSW 11 98961013 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAATGCTTCACCCAGTCACC -3'
(R):5'- GTTCTGTCTGAGAGGACAAGC -3'

Sequencing Primer
(F):5'- AGAGCAGGCCTGTGATGC -3'
(R):5'- TCACACGGCCAGCAGGAAG -3'
Posted On2019-06-07