Incidental Mutation 'R0604:Dntt'
ID55612
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
SynonymsTdt
MMRRC Submission 038793-MU
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41053149 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 424 (E424G)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
Predicted Effect probably benign
Transcript: ENSMUST00000051806
AA Change: E424G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: E424G

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112200
AA Change: E424G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: E424G

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
R8145:Dntt UTSW 19 41055785 missense probably damaging 1.00
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCAGATGCTGGATGAGGAAG -3'
(R):5'- TCGTGTGAACATGTGCCCATACC -3'

Sequencing Primer
(F):5'- CAGCTCTGAAGAGGCTCTCTTG -3'
(R):5'- TACCATGCCCCAGTTTAGAGG -3'
Posted On2013-07-11