Incidental Mutation 'PIT4486001:Tsen54'
ID556120
Institutional Source Beutler Lab
Gene Symbol Tsen54
Ensembl Gene ENSMUSG00000020781
Gene NametRNA splicing endonuclease subunit 54
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115814724-115823094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115822596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 481 (V481F)
Ref Sequence ENSEMBL: ENSMUSP00000021134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021134] [ENSMUST00000103032] [ENSMUST00000106481] [ENSMUST00000133250] [ENSMUST00000136343] [ENSMUST00000154304] [ENSMUST00000177736]
Predicted Effect probably damaging
Transcript: ENSMUST00000021134
AA Change: V481F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021134
Gene: ENSMUSG00000020781
AA Change: V481F

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 63 130 1.4e-21 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106481
AA Change: V442F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102090
Gene: ENSMUSG00000020781
AA Change: V442F

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 62 132 1.9e-23 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136343
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154304
SMART Domains Protein: ENSMUSP00000116955
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
coiled coil region 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000157061
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Tsen54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Tsen54 APN 11 115821712 missense possibly damaging 0.90
R0179:Tsen54 UTSW 11 115822030 missense probably damaging 1.00
R0255:Tsen54 UTSW 11 115815408 missense probably damaging 1.00
R0380:Tsen54 UTSW 11 115822597 missense probably damaging 1.00
R0619:Tsen54 UTSW 11 115815064 missense probably damaging 1.00
R0653:Tsen54 UTSW 11 115815061 missense probably damaging 1.00
R1120:Tsen54 UTSW 11 115815013 missense probably damaging 0.98
R2109:Tsen54 UTSW 11 115815723 missense probably damaging 1.00
R2248:Tsen54 UTSW 11 115815406 missense probably damaging 1.00
R2300:Tsen54 UTSW 11 115822078 missense probably damaging 1.00
R3081:Tsen54 UTSW 11 115820164 missense probably benign 0.08
R3763:Tsen54 UTSW 11 115820411 missense probably benign 0.22
R4179:Tsen54 UTSW 11 115820852 missense probably damaging 0.99
R4521:Tsen54 UTSW 11 115817106 critical splice donor site probably null
R4618:Tsen54 UTSW 11 115815421 unclassified probably benign
R5485:Tsen54 UTSW 11 115815222 missense probably benign 0.15
R6111:Tsen54 UTSW 11 115820130 missense possibly damaging 0.82
R6238:Tsen54 UTSW 11 115820687 missense probably benign 0.02
R6459:Tsen54 UTSW 11 115821680 missense probably damaging 1.00
R6555:Tsen54 UTSW 11 115820693 missense probably benign 0.43
R7378:Tsen54 UTSW 11 115821705 missense probably benign 0.19
R7520:Tsen54 UTSW 11 115820971 missense probably damaging 0.99
X0028:Tsen54 UTSW 11 115817099 missense possibly damaging 0.50
Z1176:Tsen54 UTSW 11 115820578 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTACTCTGGGCTCTCCTGAAG -3'
(R):5'- TCCAGGTGAGTCCTATATGAGAGAC -3'

Sequencing Primer
(F):5'- GGGCTCTCCTGAAGCACTCATC -3'
(R):5'- TCCTATATGAGAGACAGCTGGCAC -3'
Posted On2019-06-07