Incidental Mutation 'PIT4486001:Abt1'
ID556123
Institutional Source Beutler Lab
Gene Symbol Abt1
Ensembl Gene ENSMUSG00000036376
Gene Nameactivator of basal transcription 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #PIT4486001 (G1)
Quality Score165.009
Status Not validated
Chromosome13
Chromosomal Location23418361-23423866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23423681 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 51 (Y51C)
Ref Sequence ENSEMBL: ENSMUSP00000045888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041782
AA Change: Y51C

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045888
Gene: ENSMUSG00000036376
AA Change: Y51C

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
low complexity region 36 44 N/A INTRINSIC
Blast:RRM 49 141 9e-34 BLAST
SCOP:d1fxla1 50 137 4e-3 SMART
coiled coil region 166 194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Abt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Abt1 APN 13 23423768 missense unknown
IGL01917:Abt1 APN 13 23423789 missense unknown
FR4548:Abt1 UTSW 13 23423711 small deletion probably benign
FR4976:Abt1 UTSW 13 23423711 small deletion probably benign
R0029:Abt1 UTSW 13 23422508 missense possibly damaging 0.85
R2171:Abt1 UTSW 13 23422217 missense probably damaging 1.00
R4082:Abt1 UTSW 13 23422146 missense probably benign 0.00
R5125:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5178:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5204:Abt1 UTSW 13 23422668 missense probably damaging 1.00
R5947:Abt1 UTSW 13 23422055 missense possibly damaging 0.55
R6562:Abt1 UTSW 13 23423588 missense probably damaging 0.99
R8115:Abt1 UTSW 13 23422232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCGTGTACAGCCAAGAAAATG -3'
(R):5'- GGATTTACGTCATTTCTTGGCC -3'

Sequencing Primer
(F):5'- AAAATGAGTCGCGCCCG -3'
(R):5'- ACAGATTCACGGCTGTCG -3'
Posted On2019-06-07