Incidental Mutation 'PIT4486001:Tgfbi'
ID556125
Institutional Source Beutler Lab
Gene Symbol Tgfbi
Ensembl Gene ENSMUSG00000035493
Gene Nametransforming growth factor, beta induced
Synonyms68kDa, bIG-h3, Beta-ig
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #PIT4486001 (G1)
Quality Score172.009
Status Not validated
Chromosome13
Chromosomal Location56609523-56639562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56629794 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 364 (I364F)
Ref Sequence ENSEMBL: ENSMUSP00000037719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045173] [ENSMUST00000225600]
Predicted Effect probably damaging
Transcript: ENSMUST00000045173
AA Change: I364F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037719
Gene: ENSMUSG00000035493
AA Change: I364F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 139 239 1.35e-33 SMART
FAS1 276 374 6.75e-34 SMART
FAS1 411 501 1.16e-14 SMART
FAS1 538 635 6.75e-34 SMART
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225600
AA Change: I364F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show delayed growth and are prone to spontaneous and induced tumors. Homozygotes for a second null allele are prone to STZ-induced diabetes and show impaired islet function under stress. Homozygotes for a third null allele show a transient decrease in retinal apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Tgfbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Tgfbi APN 13 56630595 missense probably benign 0.41
IGL02021:Tgfbi APN 13 56631353 missense probably damaging 1.00
IGL02325:Tgfbi APN 13 56631230 missense probably benign 0.00
R0008:Tgfbi UTSW 13 56629774 missense probably benign 0.00
R0122:Tgfbi UTSW 13 56627968 missense probably damaging 1.00
R0389:Tgfbi UTSW 13 56629702 missense probably benign 0.02
R0419:Tgfbi UTSW 13 56632193 splice site probably benign
R0432:Tgfbi UTSW 13 56632191 splice site probably benign
R0671:Tgfbi UTSW 13 56638726 missense probably null 1.00
R0825:Tgfbi UTSW 13 56638710 splice site probably benign
R1263:Tgfbi UTSW 13 56630655 missense probably damaging 1.00
R1597:Tgfbi UTSW 13 56632191 splice site probably benign
R1864:Tgfbi UTSW 13 56632881 missense probably benign 0.16
R1940:Tgfbi UTSW 13 56614314 missense possibly damaging 0.92
R2570:Tgfbi UTSW 13 56638708 splice site probably null
R3111:Tgfbi UTSW 13 56609734 missense probably damaging 1.00
R3613:Tgfbi UTSW 13 56625726 missense probably damaging 1.00
R4815:Tgfbi UTSW 13 56632120 missense probably benign 0.45
R5847:Tgfbi UTSW 13 56636605 missense possibly damaging 0.94
R6314:Tgfbi UTSW 13 56626163 missense probably benign 0.01
R6810:Tgfbi UTSW 13 56637203 missense probably benign
R6821:Tgfbi UTSW 13 56626137 missense possibly damaging 0.95
R6943:Tgfbi UTSW 13 56637176 missense possibly damaging 0.77
R7165:Tgfbi UTSW 13 56628016 missense probably damaging 0.99
R7297:Tgfbi UTSW 13 56632113 missense possibly damaging 0.74
R7770:Tgfbi UTSW 13 56632844 splice site probably null
R7910:Tgfbi UTSW 13 56632184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCTCTAGACCTGTATCC -3'
(R):5'- GTTCACAGAAGGTACAGGGCTG -3'

Sequencing Primer
(F):5'- TCTTCTGCCACAGACCTGCTAAAC -3'
(R):5'- AAGGTACAGGGCTGTGTGC -3'
Posted On2019-06-07