Incidental Mutation 'PIT4486001:Abhd3'
ID556132
Institutional Source Beutler Lab
Gene Symbol Abhd3
Ensembl Gene ENSMUSG00000002475
Gene Nameabhydrolase domain containing 3
SynonymsLABH3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10644411-10706771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10645233 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 354 (I354F)
Ref Sequence ENSEMBL: ENSMUSP00000002549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002549] [ENSMUST00000117726] [ENSMUST00000117828]
Predicted Effect probably benign
Transcript: ENSMUST00000002549
AA Change: I354F

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002549
Gene: ENSMUSG00000002475
AA Change: I354F

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:Abhydrolase_1 140 252 2.4e-10 PFAM
Pfam:Abhydrolase_5 141 376 1.2e-10 PFAM
Pfam:Abhydrolase_6 142 384 9.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117726
SMART Domains Protein: ENSMUSP00000112768
Gene: ENSMUSG00000002475

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Abhydrolase_5 136 374 5.3e-10 PFAM
Pfam:Abhydrolase_6 137 379 2.8e-17 PFAM
Pfam:Abhydrolase_1 164 373 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117828
AA Change: I349F

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113137
Gene: ENSMUSG00000002475
AA Change: I349F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Abhydrolase_5 136 371 9e-11 PFAM
Pfam:Abhydrolase_6 137 383 1.6e-17 PFAM
Pfam:Abhydrolase_1 164 377 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144150
SMART Domains Protein: ENSMUSP00000116037
Gene: ENSMUSG00000002475

DomainStartEndE-ValueType
low complexity region 1 8 N/A INTRINSIC
SCOP:d1ibja_ 121 158 3e-3 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Abhd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Abhd3 APN 18 10647869 missense possibly damaging 0.94
IGL00825:Abhd3 APN 18 10704657 missense probably benign
IGL02666:Abhd3 APN 18 10645148 missense probably benign 0.00
IGL02683:Abhd3 APN 18 10658790 missense probably damaging 1.00
R0158:Abhd3 UTSW 18 10647840 missense possibly damaging 0.68
R0539:Abhd3 UTSW 18 10645208 missense possibly damaging 0.89
R4543:Abhd3 UTSW 18 10706672 missense possibly damaging 0.88
R4847:Abhd3 UTSW 18 10647786 missense possibly damaging 0.78
R5924:Abhd3 UTSW 18 10706085 missense probably damaging 1.00
R6210:Abhd3 UTSW 18 10706032 missense probably damaging 0.97
R7020:Abhd3 UTSW 18 10645127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAGTTCATGTCCGTGC -3'
(R):5'- CTGCAGAAAAGCACCTTGG -3'

Sequencing Primer
(F):5'- GAGAGTTCATGTCCGTGCTCAAC -3'
(R):5'- AGTCAAACTCATTGCATTTAGCC -3'
Posted On2019-06-07