Incidental Mutation 'R0605:Als2'
ID55615
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R0605 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59168414 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 1528 (L1528S)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
Predicted Effect probably benign
Transcript: ENSMUST00000027178
AA Change: L1528S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: L1528S

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163058
AA Change: L1528S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: L1528S

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190598
Meta Mutation Damage Score 0.1282 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mdm1 C T 10: 118,146,601 T47M probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1097 T C 2: 86,890,419 Y252C possibly damaging Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Phlpp2 A G 8: 109,933,211 N721S probably benign Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Plppr1 A T 4: 49,323,466 N252I probably damaging Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prom2 C A 2: 127,539,995 probably null Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vps8 A T 16: 21,559,337 T1033S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8478:Als2 UTSW 1 59186016 missense probably damaging 0.96
R8492:Als2 UTSW 1 59211344 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGCACACAGATAAATCTCCAGGCA -3'
(R):5'- tcccaGCCAGATATAGTTTCTTCTCAGG -3'

Sequencing Primer
(F):5'- ACATGAGGCATTACCTGATCTGC -3'
(R):5'- AAGCCATTTCCAGGATGTTTAC -3'
Posted On2013-07-11