Incidental Mutation 'PIT4494001:Tox4'
ID556162
Institutional Source Beutler Lab
Gene Symbol Tox4
Ensembl Gene ENSMUSG00000016831
Gene NameTOX high mobility group box family member 4
Synonyms5730589K01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4494001 (G1)
Quality Score164.009
Status Not validated
Chromosome14
Chromosomal Location52279146-52296401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52291803 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 407 (T407I)
Ref Sequence ENSEMBL: ENSMUSP00000022766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766] [ENSMUST00000022767] [ENSMUST00000147768] [ENSMUST00000174351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022766
AA Change: T407I

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831
AA Change: T407I

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022767
SMART Domains Protein: ENSMUSP00000022767
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
Pfam:MT-A70 389 550 9.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147768
SMART Domains Protein: ENSMUSP00000134577
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173656
SMART Domains Protein: ENSMUSP00000133759
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 60 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174351
SMART Domains Protein: ENSMUSP00000134732
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 140 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174360
SMART Domains Protein: ENSMUSP00000134578
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 34 4.3e-10 PFAM
Pfam:MT-A70 30 74 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.6%
  • 20x: 73.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik T C 4: 123,860,905 I204T probably benign Het
Acnat2 T C 4: 49,383,133 E140G probably benign Het
Arhgef10l T C 4: 140,565,211 E413G probably damaging Het
Atg9a A T 1: 75,187,953 C122* probably null Het
Birc6 T C 17: 74,626,980 Y2544H probably damaging Het
C3 G A 17: 57,209,263 T1383I probably benign Het
Cd2ap C T 17: 42,852,367 probably null Het
Cdhr1 T C 14: 37,082,856 T466A probably benign Het
Cdhr2 G T 13: 54,718,442 probably null Het
Eppk1 T A 15: 76,106,072 Q2203L probably benign Het
F10 T C 8: 13,053,423 L281P probably damaging Het
Farp2 A G 1: 93,617,594 T825A probably damaging Het
Fbxw27 T C 9: 109,772,110 E314G probably benign Het
Foxred1 T C 9: 35,209,059 E173G possibly damaging Het
Gm4847 T C 1: 166,640,018 E203G probably damaging Het
Gpat2 G A 2: 127,433,880 R526H probably benign Het
Grin2a T C 16: 9,585,096 Y842C probably damaging Het
Hyal4 T C 6: 24,755,834 V17A probably benign Het
Igkv4-68 T C 6: 69,305,107 T27A probably damaging Het
Loxhd1 A T 18: 77,441,768 N2036Y probably damaging Het
Lrp5 T C 19: 3,610,091 Y991C probably damaging Het
Lrp6 T C 6: 134,479,778 Y841C probably damaging Het
Medag A G 5: 149,427,300 Y194C probably damaging Het
Mynn C T 3: 30,607,722 R318* probably null Het
Notch1 C T 2: 26,466,473 V1711M probably damaging Het
Nsun2 T C 13: 69,618,192 probably null Het
Pex7 A G 10: 19,894,723 probably null Het
Pkd1 A G 17: 24,577,801 T2417A probably damaging Het
Pknox2 A G 9: 36,954,691 probably null Het
Plekha4 T C 7: 45,548,079 S522P probably damaging Het
Ptcd1 A T 5: 145,155,358 S310R probably benign Het
Rap2a A G 14: 120,478,907 T61A possibly damaging Het
Ryr3 G T 2: 112,841,876 L1437M probably damaging Het
Slc25a40 T G 5: 8,440,737 I95S probably damaging Het
Srbd1 C T 17: 86,142,359 probably null Het
Vmn1r8 A G 6: 57,036,727 I254M probably benign Het
Wiz G A 17: 32,361,931 A182V probably damaging Het
Zfp60 T C 7: 27,748,701 S265P probably damaging Het
Other mutations in Tox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tox4 APN 14 52285745 missense probably damaging 1.00
Gift UTSW 14 52286756 missense probably damaging 1.00
R0517:Tox4 UTSW 14 52292628 missense probably benign 0.01
R0801:Tox4 UTSW 14 52279878 missense probably benign 0.28
R1640:Tox4 UTSW 14 52292543 missense possibly damaging 0.53
R2980:Tox4 UTSW 14 52292526 missense probably benign 0.00
R3899:Tox4 UTSW 14 52279842 missense probably damaging 0.98
R4016:Tox4 UTSW 14 52285904 critical splice donor site probably null
R4614:Tox4 UTSW 14 52287467 missense probably damaging 0.99
R5764:Tox4 UTSW 14 52285820 missense probably damaging 0.96
R5847:Tox4 UTSW 14 52286784 missense probably damaging 0.99
R6669:Tox4 UTSW 14 52286756 missense probably damaging 1.00
R6978:Tox4 UTSW 14 52287237 intron probably null
R7155:Tox4 UTSW 14 52292097 missense probably benign
R7770:Tox4 UTSW 14 52279842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACCAAGCCTCTTCTGG -3'
(R):5'- GCACAATCTTGCTCTGCAGAG -3'

Sequencing Primer
(F):5'- AAGCCTCTTCTGGGCCTG -3'
(R):5'- CTGCTGCTGTAAGTTGATTCTAAC -3'
Posted On2019-06-07