Incidental Mutation 'PIT4687001:Qsox2'
ID556175
Institutional Source Beutler Lab
Gene Symbol Qsox2
Ensembl Gene ENSMUSG00000036327
Gene Namequiescin Q6 sulfhydryl oxidase 2
SynonymsQSOX2, Qscn6l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26208637-26237525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26222288 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 81 (L81F)
Ref Sequence ENSEMBL: ENSMUSP00000088807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036187] [ENSMUST00000091263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036187
AA Change: L246F

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037128
Gene: ENSMUSG00000036327
AA Change: L246F

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Thioredoxin 59 166 1.7e-15 PFAM
low complexity region 295 310 N/A INTRINSIC
Blast:HOX 355 398 6e-14 BLAST
Pfam:Evr1_Alr 424 525 3.4e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000091263
AA Change: L81F

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088807
Gene: ENSMUSG00000036327
AA Change: L81F

DomainStartEndE-ValueType
low complexity region 130 145 N/A INTRINSIC
Blast:HOX 190 233 1e-13 BLAST
Pfam:Evr1_Alr 259 361 2.4e-30 PFAM
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the sulfhydryl oxidase protein family. Members of this family catalyze formation of disulfide bonds. A similar protein in humans may sensitize neuroblastoma cells to interferon gamma-induced cell death. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Qsox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Qsox2 APN 2 26222255 missense probably benign 0.15
IGL01067:Qsox2 APN 2 26228396 missense probably damaging 1.00
IGL01105:Qsox2 APN 2 26209685 missense probably benign 0.00
IGL02420:Qsox2 APN 2 26220719 missense probably benign 0.07
IGL03323:Qsox2 APN 2 26220979 missense probably benign
PIT4377001:Qsox2 UTSW 2 26220912 missense probably damaging 0.99
PIT4677001:Qsox2 UTSW 2 26222308 missense probably damaging 1.00
R0559:Qsox2 UTSW 2 26214157 missense probably benign 0.05
R0594:Qsox2 UTSW 2 26214044 missense probably damaging 1.00
R1055:Qsox2 UTSW 2 26214125 missense probably damaging 1.00
R1657:Qsox2 UTSW 2 26220747 nonsense probably null
R1727:Qsox2 UTSW 2 26220958 missense probably benign 0.00
R1746:Qsox2 UTSW 2 26220638 missense probably benign
R1858:Qsox2 UTSW 2 26214062 missense probably damaging 1.00
R2309:Qsox2 UTSW 2 26228433 missense possibly damaging 0.61
R5291:Qsox2 UTSW 2 26217698 missense probably damaging 1.00
R5298:Qsox2 UTSW 2 26214062 missense probably damaging 0.96
R5524:Qsox2 UTSW 2 26217687 missense probably damaging 1.00
R5567:Qsox2 UTSW 2 26225218 start codon destroyed probably null
R5570:Qsox2 UTSW 2 26225218 start codon destroyed probably null
R5965:Qsox2 UTSW 2 26222221 missense probably benign 0.06
R6529:Qsox2 UTSW 2 26217741 missense probably damaging 1.00
R6957:Qsox2 UTSW 2 26217642 missense probably benign 0.40
R7185:Qsox2 UTSW 2 26220706 missense possibly damaging 0.63
R7250:Qsox2 UTSW 2 26228432 missense probably damaging 1.00
R7637:Qsox2 UTSW 2 26221020 missense probably damaging 1.00
R8076:Qsox2 UTSW 2 26224885 missense possibly damaging 0.55
Z1176:Qsox2 UTSW 2 26217666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCCAGCTAGAGTCTGTCAC -3'
(R):5'- TGAACAAGGTTTTCCACACGTG -3'

Sequencing Primer
(F):5'- CGTGGACTCTGAGCCTTTATCCAG -3'
(R):5'- CGGATAGTTCAGCACCTGTGAG -3'
Posted On2019-06-07