Incidental Mutation 'PIT4687001:March7'
ID556176
Institutional Source Beutler Lab
Gene Symbol March7
Ensembl Gene ENSMUSG00000026977
Gene Namemembrane-associated ring finger (C3HC4) 7
SynonymsAxot, Gtrgeo17
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60209887-60250676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60232278 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 143 (E143G)
Ref Sequence ENSEMBL: ENSMUSP00000068961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067542] [ENSMUST00000102747] [ENSMUST00000102748]
Predicted Effect probably damaging
Transcript: ENSMUST00000067542
AA Change: E143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068961
Gene: ENSMUSG00000026977
AA Change: E143G

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102747
AA Change: E143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099808
Gene: ENSMUSG00000026977
AA Change: E143G

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102748
AA Change: E143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099809
Gene: ENSMUSG00000026977
AA Change: E143G

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142485
SMART Domains Protein: ENSMUSP00000116925
Gene: ENSMUSG00000026977

DomainStartEndE-ValueType
RINGv 15 72 2.11e-21 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH7 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous null mice show premature neural degeneration and defective development of the corpus callosum. Both T cell proliferation and T cell-derived leukaemia inhibitory factor are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in March7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:March7 APN 2 60234195 missense probably benign 0.01
IGL02001:March7 APN 2 60234891 missense possibly damaging 0.95
IGL02927:March7 APN 2 60236918 missense probably damaging 1.00
R0379:March7 UTSW 2 60234126 missense probably benign 0.00
R1722:March7 UTSW 2 60234182 missense probably damaging 1.00
R1755:March7 UTSW 2 60234921 missense probably benign
R1759:March7 UTSW 2 60234544 missense probably damaging 1.00
R1809:March7 UTSW 2 60232293 missense probably benign 0.16
R2018:March7 UTSW 2 60229040 nonsense probably null
R2226:March7 UTSW 2 60229846 missense probably benign 0.13
R2227:March7 UTSW 2 60229846 missense probably benign 0.13
R2471:March7 UTSW 2 60236900 missense possibly damaging 0.80
R3724:March7 UTSW 2 60229745 missense probably benign 0.10
R4349:March7 UTSW 2 60234195 missense probably benign 0.01
R4667:March7 UTSW 2 60241050 nonsense probably null
R5365:March7 UTSW 2 60233914 missense possibly damaging 0.48
R5524:March7 UTSW 2 60245303 intron probably benign
R5860:March7 UTSW 2 60236843 missense probably damaging 1.00
R5883:March7 UTSW 2 60234442 missense probably damaging 1.00
R5945:March7 UTSW 2 60240987 missense probably damaging 1.00
R5992:March7 UTSW 2 60245220 missense probably benign 0.14
R6937:March7 UTSW 2 60240966 missense probably damaging 1.00
R6944:March7 UTSW 2 60234243 missense probably benign 0.08
R6992:March7 UTSW 2 60229084 critical splice donor site probably null
R7337:March7 UTSW 2 60240845 splice site probably null
R7448:March7 UTSW 2 60247514 critical splice donor site probably null
R7577:March7 UTSW 2 60229704 nonsense probably null
R7712:March7 UTSW 2 60234990 nonsense probably null
R7863:March7 UTSW 2 60241022 missense probably benign 0.35
R8281:March7 UTSW 2 60234529 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGGGTTAGGTTTTAGCACC -3'
(R):5'- CCCTCCAGTGTAGTTTTATAATGAC -3'

Sequencing Primer
(F):5'- CCTGGGTTAGGTTTTAGCACCAAAAG -3'
(R):5'- GACACAGGGAACATTTGTAATAACAC -3'
Posted On2019-06-07