Incidental Mutation 'PIT4687001:Olfr1267-ps1'
ID556177
Institutional Source Beutler Lab
Gene Symbol Olfr1267-ps1
Ensembl Gene ENSMUSG00000084336
Gene Nameolfactory receptor 1267, pseudogene 1
SynonymsGA_x6K02T2Q125-51518604-51517675, MOR228-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90085530-90086459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90086389 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 24 (V24A)
Ref Sequence ENSEMBL: ENSMUSP00000150445 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000118957
AA Change: V24A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Olfr1267-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6801:Olfr1267-ps1 UTSW 2 90085609 missense probably damaging 1.00
R7263:Olfr1267-ps1 UTSW 2 90085988 missense not run
R7489:Olfr1267-ps1 UTSW 2 90086360 missense probably benign
R7512:Olfr1267-ps1 UTSW 2 90085696 missense possibly damaging 0.94
R7620:Olfr1267-ps1 UTSW 2 90085633 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGATCCAAGATGAGTTTTGTGGC -3'
(R):5'- TGGCAGCCATACACAATGC -3'

Sequencing Primer
(F):5'- CTGTCATGGAGGAGTATCAGATCTCC -3'
(R):5'- ACACAATGCACTCACACTTTCTCTG -3'
Posted On2019-06-07