Incidental Mutation 'PIT4687001:Mcm8'
ID556178
Institutional Source Beutler Lab
Gene Symbol Mcm8
Ensembl Gene ENSMUSG00000027353
Gene Nameminichromosome maintenance 8 homologous recombination repair factor
Synonyms5730432L01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132816141-132844197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132817177 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 27 (F27S)
Ref Sequence ENSEMBL: ENSMUSP00000028831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028831] [ENSMUST00000039554] [ENSMUST00000066559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028831
AA Change: F27S

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028831
Gene: ENSMUSG00000027353
AA Change: F27S

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
Blast:MCM 79 155 2e-28 BLAST
MCM 198 742 2.42e-136 SMART
AAA 439 590 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039554
SMART Domains Protein: ENSMUSP00000044687
Gene: ENSMUSG00000037376

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Gcd10p 20 302 7.2e-74 PFAM
coiled coil region 345 364 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066559
AA Change: F27S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066842
Gene: ENSMUSG00000027353
AA Change: F27S

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:MCM 51 127 2e-28 BLAST
MCM 170 714 2.42e-136 SMART
AAA 411 562 5.99e-6 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility associated with impaired ovarian development and arrested male meiosis, and impaired sensitivity to homologous recombination double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Mcm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Mcm8 APN 2 132827537 missense probably benign
IGL00479:Mcm8 APN 2 132817174 missense probably benign
IGL00573:Mcm8 APN 2 132832812 missense possibly damaging 0.94
IGL00847:Mcm8 APN 2 132819674 missense probably benign 0.29
IGL00978:Mcm8 APN 2 132821406 missense probably benign
IGL01390:Mcm8 APN 2 132838078 splice site probably benign
IGL01785:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL01786:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL02216:Mcm8 APN 2 132839529 missense probably damaging 1.00
IGL03191:Mcm8 APN 2 132821442 missense possibly damaging 0.68
madamina UTSW 2 132832854 missense probably damaging 1.00
R0329:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R0330:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R1520:Mcm8 UTSW 2 132839455 missense probably benign 0.39
R1771:Mcm8 UTSW 2 132843556 nonsense probably null
R1967:Mcm8 UTSW 2 132842742 missense probably benign
R2228:Mcm8 UTSW 2 132820121 missense possibly damaging 0.85
R2418:Mcm8 UTSW 2 132824738 missense probably benign
R4728:Mcm8 UTSW 2 132832854 missense probably damaging 1.00
R4827:Mcm8 UTSW 2 132823254 missense probably damaging 0.99
R4847:Mcm8 UTSW 2 132820003 missense probably benign 0.01
R4928:Mcm8 UTSW 2 132839479 missense probably benign 0.00
R4932:Mcm8 UTSW 2 132838709 missense probably benign 0.09
R4962:Mcm8 UTSW 2 132838769 missense probably damaging 1.00
R6044:Mcm8 UTSW 2 132831680 critical splice donor site probably null
R6081:Mcm8 UTSW 2 132828083 missense probably benign 0.00
R6650:Mcm8 UTSW 2 132821407 missense probably benign 0.01
R6685:Mcm8 UTSW 2 132842650 missense probably damaging 1.00
R7006:Mcm8 UTSW 2 132823261 missense probably damaging 1.00
R7176:Mcm8 UTSW 2 132820072 missense probably benign 0.01
R7328:Mcm8 UTSW 2 132832857 missense probably benign 0.28
R7486:Mcm8 UTSW 2 132839520 missense probably damaging 1.00
R7631:Mcm8 UTSW 2 132828043 missense not run
R7664:Mcm8 UTSW 2 132843533 missense probably damaging 0.96
R7820:Mcm8 UTSW 2 132840772 missense possibly damaging 0.68
R8090:Mcm8 UTSW 2 132831649 missense probably benign 0.30
R8228:Mcm8 UTSW 2 132842794 critical splice donor site probably null
Z1176:Mcm8 UTSW 2 132827567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTTTGCAAGCCTAAGTGC -3'
(R):5'- TGCCTGTGCACACTAGTAGG -3'

Sequencing Primer
(F):5'- GCCTAAGTGCTGGTCTTAAACACAG -3'
(R):5'- CACACATGCCATAGTGCATATGTGG -3'
Posted On2019-06-07