Incidental Mutation 'PIT4687001:Stpg2'
ID556180
Institutional Source Beutler Lab
Gene Symbol Stpg2
Ensembl Gene ENSMUSG00000047940
Gene Namesperm tail PG rich repeat containing 2
SynonymsLOC381476, B930007M17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #PIT4687001 (G1)
Quality Score86.0076
Status Not validated
Chromosome3
Chromosomal Location139205694-139710299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139215265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 77 (I77T)
Ref Sequence ENSEMBL: ENSMUSP00000051539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062306] [ENSMUST00000106239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062306
AA Change: I77T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051539
Gene: ENSMUSG00000047940
AA Change: I77T

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 20 50 1.1e1 PFAM
Pfam:SHIPPO-rpt 62 92 1.3e1 PFAM
Pfam:SHIPPO-rpt 97 127 9.1e1 PFAM
Pfam:SHIPPO-rpt 162 193 1.3e2 PFAM
Pfam:SHIPPO-rpt 200 235 1.7e0 PFAM
Pfam:SHIPPO-rpt 249 285 1.2e-2 PFAM
Pfam:SHIPPO-rpt 292 315 3.2e1 PFAM
Pfam:SHIPPO-rpt 334 371 2.1e0 PFAM
Pfam:SHIPPO-rpt 421 462 3.8e0 PFAM
Pfam:SHIPPO-rpt 471 497 2.9e1 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106239
AA Change: I77T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101846
Gene: ENSMUSG00000047940
AA Change: I77T

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 200 220 6.9e-1 PFAM
Pfam:SHIPPO-rpt 249 285 8.8e-2 PFAM
Pfam:SHIPPO-rpt 334 371 5.4e-2 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Stpg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Stpg2 APN 3 139419874 splice site probably benign
IGL01505:Stpg2 APN 3 139317453 missense probably benign 0.02
IGL01649:Stpg2 APN 3 139419862 missense probably damaging 1.00
IGL03264:Stpg2 APN 3 139309209 missense possibly damaging 0.72
R0053:Stpg2 UTSW 3 139212321 missense probably benign 0.00
R0099:Stpg2 UTSW 3 139243193 splice site probably benign
R0417:Stpg2 UTSW 3 139218321 missense probably damaging 1.00
R1646:Stpg2 UTSW 3 139419702 splice site probably benign
R1719:Stpg2 UTSW 3 139232199 missense probably benign 0.11
R1791:Stpg2 UTSW 3 139317401 missense probably benign 0.00
R1799:Stpg2 UTSW 3 139419781 missense probably damaging 1.00
R1912:Stpg2 UTSW 3 139522981 splice site probably null
R1974:Stpg2 UTSW 3 139309183 nonsense probably null
R3725:Stpg2 UTSW 3 139317477 missense probably benign 0.00
R3727:Stpg2 UTSW 3 139298496 missense probably damaging 1.00
R4225:Stpg2 UTSW 3 139215292 missense probably damaging 0.97
R4694:Stpg2 UTSW 3 139317416 missense possibly damaging 0.94
R4698:Stpg2 UTSW 3 139309229 missense probably damaging 1.00
R4879:Stpg2 UTSW 3 139215373 missense probably benign 0.03
R5236:Stpg2 UTSW 3 139232223 missense probably damaging 1.00
R5476:Stpg2 UTSW 3 139243138 missense probably benign 0.03
R5567:Stpg2 UTSW 3 139419786 missense probably benign 0.22
R6297:Stpg2 UTSW 3 139701671 missense possibly damaging 0.91
R6692:Stpg2 UTSW 3 139522977 critical splice donor site probably null
R7113:Stpg2 UTSW 3 139701774 critical splice donor site probably null
R7154:Stpg2 UTSW 3 139215295 missense probably benign 0.44
R7553:Stpg2 UTSW 3 139218337 missense probably damaging 1.00
R7660:Stpg2 UTSW 3 139701697 missense probably damaging 0.98
R8105:Stpg2 UTSW 3 139243164 missense probably damaging 1.00
R8154:Stpg2 UTSW 3 139309177 missense probably damaging 1.00
RF021:Stpg2 UTSW 3 139212250 critical splice acceptor site probably null
X0009:Stpg2 UTSW 3 139298462 missense probably benign 0.00
X0018:Stpg2 UTSW 3 139243090 missense probably benign 0.44
Z1176:Stpg2 UTSW 3 139701640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACGTTTGGAAAATCCTGACTTTG -3'
(R):5'- GAAGCTACTTAAGAAGTGACACAC -3'

Sequencing Primer
(F):5'- GGAAAATCCTGACTTTGATCACTTCC -3'
(R):5'- GTGACACACTGCAGATGTTC -3'
Posted On2019-06-07