Incidental Mutation 'PIT4687001:Gm13103'
ID556184
Institutional Source Beutler Lab
Gene Symbol Gm13103
Ensembl Gene ENSMUSG00000029451
Gene Namepredicted gene 13103
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143846497-143853637 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 143846533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094522] [ENSMUST00000105768] [ENSMUST00000139747]
Predicted Effect probably benign
Transcript: ENSMUST00000094522
SMART Domains Protein: ENSMUSP00000092099
Gene: ENSMUSG00000029451

DomainStartEndE-ValueType
low complexity region 403 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105768
Predicted Effect probably benign
Transcript: ENSMUST00000139747
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Gm13103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Gm13103 APN 4 143853276 missense probably benign 0.01
IGL01383:Gm13103 APN 4 143846532 utr 5 prime probably benign
IGL01735:Gm13103 APN 4 143851831 missense probably damaging 1.00
IGL01976:Gm13103 APN 4 143852793 missense probably benign 0.17
IGL03096:Gm13103 APN 4 143850915 missense probably benign 0.01
IGL03280:Gm13103 APN 4 143851919 missense possibly damaging 0.74
IGL03295:Gm13103 APN 4 143853189 missense probably damaging 1.00
FR4342:Gm13103 UTSW 4 143851643 frame shift probably null
R0218:Gm13103 UTSW 4 143851831 missense probably damaging 1.00
R0612:Gm13103 UTSW 4 143852088 unclassified probably benign
R1755:Gm13103 UTSW 4 143850810 missense probably damaging 1.00
R2509:Gm13103 UTSW 4 143851991 missense probably benign 0.01
R2510:Gm13103 UTSW 4 143851991 missense probably benign 0.01
R2511:Gm13103 UTSW 4 143851991 missense probably benign 0.01
R4603:Gm13103 UTSW 4 143852881 missense probably benign 0.01
R4694:Gm13103 UTSW 4 143852960 missense probably damaging 0.97
R4856:Gm13103 UTSW 4 143853303 missense probably benign 0.00
R4886:Gm13103 UTSW 4 143853303 missense probably benign 0.00
R4927:Gm13103 UTSW 4 143851617 missense probably damaging 1.00
R5168:Gm13103 UTSW 4 143853198 missense probably benign 0.02
R5270:Gm13103 UTSW 4 143851898 missense probably damaging 0.97
R5402:Gm13103 UTSW 4 143851655 critical splice donor site probably null
R5618:Gm13103 UTSW 4 143850693 missense possibly damaging 0.92
R6078:Gm13103 UTSW 4 143851585 missense possibly damaging 0.58
R6138:Gm13103 UTSW 4 143851585 missense possibly damaging 0.58
R6362:Gm13103 UTSW 4 143852865 missense probably damaging 0.99
R6526:Gm13103 UTSW 4 143852814 missense probably damaging 1.00
R6555:Gm13103 UTSW 4 143851570 missense possibly damaging 0.58
R6595:Gm13103 UTSW 4 143852756 missense probably damaging 1.00
R6675:Gm13103 UTSW 4 143853258 missense probably damaging 0.98
R7216:Gm13103 UTSW 4 143851829 missense probably damaging 0.96
R7282:Gm13103 UTSW 4 143851881 missense possibly damaging 0.85
R7424:Gm13103 UTSW 4 143853209 missense probably benign 0.01
R7511:Gm13103 UTSW 4 143846546 missense possibly damaging 0.68
R7591:Gm13103 UTSW 4 143850911 missense probably benign 0.01
R7868:Gm13103 UTSW 4 143851584 missense possibly damaging 0.58
R8192:Gm13103 UTSW 4 143851539 nonsense probably null
R8244:Gm13103 UTSW 4 143853284 missense probably damaging 1.00
R8256:Gm13103 UTSW 4 143851685 missense probably benign 0.05
U15987:Gm13103 UTSW 4 143851585 missense possibly damaging 0.58
Z1176:Gm13103 UTSW 4 143853110 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCCTGAGTACAGATCTGATCCAAATTA -3'
(R):5'- TTATGTGAACAAAATTTCAAGTGAGG -3'

Sequencing Primer
(F):5'- AGGCATACTTTGGCTTGG -3'
(R):5'- TAATCCCAGCACTTGTGAGG -3'
Posted On2019-06-07