Incidental Mutation 'PIT4687001:Gp2'
ID556188
Institutional Source Beutler Lab
Gene Symbol Gp2
Ensembl Gene ENSMUSG00000030954
Gene Nameglycoprotein 2 (zymogen granule membrane)
Synonyms2310037I18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119442537-119459285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119451578 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 310 (R310H)
Ref Sequence ENSEMBL: ENSMUSP00000146487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]
Predicted Effect probably benign
Transcript: ENSMUST00000033255
AA Change: R310H

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954
AA Change: R310H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:ZP 164 213 1e-11 BLAST
ZP 225 477 5.39e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207887
AA Change: R310H

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Gp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gp2 APN 7 119454390 missense probably damaging 0.96
IGL00818:Gp2 APN 7 119450127 missense possibly damaging 0.82
IGL01830:Gp2 APN 7 119451542 missense probably damaging 1.00
IGL02088:Gp2 APN 7 119454469 missense probably damaging 1.00
IGL02284:Gp2 APN 7 119450183 missense probably damaging 1.00
IGL02812:Gp2 APN 7 119452229 missense probably benign 0.01
IGL03049:Gp2 APN 7 119450294 missense possibly damaging 0.82
IGL03368:Gp2 APN 7 119452874 missense probably damaging 1.00
IGL03369:Gp2 APN 7 119451560 missense probably damaging 0.98
R0179:Gp2 UTSW 7 119452317 missense possibly damaging 0.81
R0367:Gp2 UTSW 7 119454568 missense probably damaging 1.00
R0544:Gp2 UTSW 7 119454496 missense probably benign 0.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0974:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R1413:Gp2 UTSW 7 119451630 missense probably benign 0.15
R1557:Gp2 UTSW 7 119450079 missense probably damaging 1.00
R1638:Gp2 UTSW 7 119451498 critical splice donor site probably null
R1709:Gp2 UTSW 7 119451585 missense probably null 1.00
R1932:Gp2 UTSW 7 119454232 missense possibly damaging 0.81
R2109:Gp2 UTSW 7 119452932 missense probably benign
R2159:Gp2 UTSW 7 119452284 missense probably benign 0.06
R2285:Gp2 UTSW 7 119450085 missense possibly damaging 0.82
R4657:Gp2 UTSW 7 119457168 missense probably benign 0.38
R4829:Gp2 UTSW 7 119457184 missense possibly damaging 0.56
R4854:Gp2 UTSW 7 119452199 missense possibly damaging 0.72
R4927:Gp2 UTSW 7 119452895 missense probably benign 0.00
R5022:Gp2 UTSW 7 119449114 missense probably damaging 1.00
R5033:Gp2 UTSW 7 119454291 missense probably damaging 0.99
R5443:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5444:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5681:Gp2 UTSW 7 119452294 missense possibly damaging 0.92
R5732:Gp2 UTSW 7 119449108 missense probably damaging 1.00
R5964:Gp2 UTSW 7 119449129 missense probably benign 0.02
R6963:Gp2 UTSW 7 119452897 missense probably benign 0.03
R7014:Gp2 UTSW 7 119451645 missense probably damaging 1.00
R7087:Gp2 UTSW 7 119450232 missense probably damaging 0.99
R7223:Gp2 UTSW 7 119451498 critical splice donor site probably null
R7497:Gp2 UTSW 7 119454606 missense probably damaging 1.00
R8165:Gp2 UTSW 7 119450152 missense probably damaging 1.00
R8343:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8344:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8345:Gp2 UTSW 7 119442787 missense probably benign 0.01
X0026:Gp2 UTSW 7 119442819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGTGCCTTGATCATACTG -3'
(R):5'- TGGGAACACTGACCATAGAAC -3'

Sequencing Primer
(F):5'- CAGTGCCTTGATCATACTGAATGTTC -3'
(R):5'- GGGAACACTGACCATAGAACCAGAC -3'
Posted On2019-06-07