Incidental Mutation 'PIT4687001:Ubash3b'
ID556192
Institutional Source Beutler Lab
Gene Symbol Ubash3b
Ensembl Gene ENSMUSG00000032020
Gene Nameubiquitin associated and SH3 domain containing, B
Synonyms2810457I06Rik, TULA-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location41011098-41161697 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41023518 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 489 (F489L)
Ref Sequence ENSEMBL: ENSMUSP00000043865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044155] [ENSMUST00000151485]
PDB Structure
Crystal Structure of the PGM domain of the Suppressor of T-Cell receptor (Sts-1) [X-RAY DIFFRACTION]
Crystal structure of mouse Sts-1 PGM domain in complex with phosphate [X-RAY DIFFRACTION]
The 1.35 A Structure of the Phosphatase Domain of the Suppressor of T Cell Receptor Signalling Protein in Complex with Sulphate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000044155
AA Change: F489L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043865
Gene: ENSMUSG00000032020
AA Change: F489L

DomainStartEndE-ValueType
UBA 26 64 2.43e-4 SMART
low complexity region 177 186 N/A INTRINSIC
SH3 246 307 7.29e-10 SMART
Pfam:His_Phos_1 415 598 3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151485
AA Change: F367L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116038
Gene: ENSMUSG00000032020
AA Change: F367L

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
SH3 124 185 7.29e-10 SMART
Pfam:His_Phos_1 252 450 1.9e-27 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, developmentally normal, and do not display any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Ubash3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ubash3b APN 9 41018015 critical splice donor site probably null
IGL01734:Ubash3b APN 9 41026247 splice site probably benign
IGL02311:Ubash3b APN 9 41047037 missense probably benign
IGL03406:Ubash3b APN 9 41037479 missense probably damaging 1.00
PIT4618001:Ubash3b UTSW 9 41016627 missense probably benign 0.00
R0524:Ubash3b UTSW 9 41016608 missense probably benign 0.16
R0666:Ubash3b UTSW 9 41047064 missense possibly damaging 0.67
R0927:Ubash3b UTSW 9 41023557 nonsense probably null
R1112:Ubash3b UTSW 9 41028116 missense probably damaging 1.00
R1544:Ubash3b UTSW 9 41016605 missense probably damaging 1.00
R1596:Ubash3b UTSW 9 41031497 missense probably benign
R1610:Ubash3b UTSW 9 41043500 missense probably damaging 1.00
R2069:Ubash3b UTSW 9 41043573 missense possibly damaging 0.82
R2507:Ubash3b UTSW 9 41157354 missense possibly damaging 0.90
R2520:Ubash3b UTSW 9 41014947 missense probably damaging 1.00
R3899:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R3900:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R4715:Ubash3b UTSW 9 41016600 missense probably damaging 1.00
R4876:Ubash3b UTSW 9 41018109 missense probably benign 0.00
R5023:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5034:Ubash3b UTSW 9 41029740 missense probably benign 0.25
R5057:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5396:Ubash3b UTSW 9 41043473 critical splice donor site probably null
R5448:Ubash3b UTSW 9 41037435 critical splice donor site probably null
R5760:Ubash3b UTSW 9 41077423 missense probably benign 0.00
R6178:Ubash3b UTSW 9 41014916 missense probably damaging 0.96
R6392:Ubash3b UTSW 9 41014972 missense probably damaging 1.00
R8115:Ubash3b UTSW 9 41026328 missense probably damaging 1.00
R8406:Ubash3b UTSW 9 41029675 missense probably damaging 1.00
R8411:Ubash3b UTSW 9 41043485 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTTGCTAGGTTTATCATCAGCTTG -3'
(R):5'- CATCATCACTGTGGCTCAGAG -3'

Sequencing Primer
(F):5'- CATCAGCTTGTTGAACATGGTC -3'
(R):5'- CACTATAGCTAGGTAGGACTTACG -3'
Posted On2019-06-07