Incidental Mutation 'PIT4687001:Ppp2r3a'
ID556194
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4687001 (G1)
Quality Score219.009
Status Not validated
Chromosome9
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101144380 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 332 (E332G)
Ref Sequence ENSEMBL: ENSMUSP00000069688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
AA Change: E332G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154
AA Change: E332G

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
AA Change: E952G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: E952G

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4480001:Ppp2r3a UTSW 9 101126377 missense possibly damaging 0.95
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1086:Ppp2r3a UTSW 9 101153822 missense possibly damaging 0.67
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R5939:Ppp2r3a UTSW 9 101212625 missense probably benign 0.37
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6574:Ppp2r3a UTSW 9 101194385 missense probably benign 0.03
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7189:Ppp2r3a UTSW 9 101126422 missense possibly damaging 0.59
R7190:Ppp2r3a UTSW 9 101212527 missense probably benign 0.11
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
R7512:Ppp2r3a UTSW 9 101175333 missense possibly damaging 0.69
R7655:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
R7656:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Z1176:Ppp2r3a UTSW 9 101126389 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CACCCCATGACCATGCATTCTG -3'
(R):5'- AAGGGGTTGCCCTTTCTGAAC -3'

Sequencing Primer
(F):5'- TGAGCTCCTCCAGGACAGAC -3'
(R):5'- CTAAAGAGTGTTACTTT -3'
Posted On2019-06-07