Incidental Mutation 'PIT4687001:Ptpdc1'
ID556199
Institutional Source Beutler Lab
Gene Symbol Ptpdc1
Ensembl Gene ENSMUSG00000038042
Gene Nameprotein tyrosine phosphatase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4687001 (G1)
Quality Score114.008
Status Not validated
Chromosome13
Chromosomal Location48577872-48625664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48586290 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 555 (V555A)
Ref Sequence ENSEMBL: ENSMUSP00000152771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035824] [ENSMUST00000222028] [ENSMUST00000223025]
Predicted Effect probably benign
Transcript: ENSMUST00000035824
AA Change: V494A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000047374
Gene: ENSMUSG00000038042
AA Change: V494A

DomainStartEndE-ValueType
Pfam:DSPc 102 243 1.1e-13 PFAM
Pfam:Y_phosphatase 144 242 8.9e-10 PFAM
low complexity region 598 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222028
AA Change: V555A

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223025
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a centrosomal mitotic phosphatase. This protein has been implicated in centrosomal duplication and cytokinesis. In addition, knockdown of expression levels in non-cycling cells results in extra long cilia, suggesting that this protein may function in regulating cilia length independent of a function in cell cycle control. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Ptpdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Ptpdc1 APN 13 48587058 missense possibly damaging 0.80
IGL01410:Ptpdc1 APN 13 48586604 missense probably damaging 0.99
IGL02931:Ptpdc1 APN 13 48590619 splice site probably benign
IGL03180:Ptpdc1 APN 13 48586077 missense probably damaging 1.00
PIT4519001:Ptpdc1 UTSW 13 48583156 missense probably benign 0.29
R0014:Ptpdc1 UTSW 13 48586919 nonsense probably null
R0244:Ptpdc1 UTSW 13 48585980 missense probably benign 0.00
R0420:Ptpdc1 UTSW 13 48589119 critical splice donor site probably null
R0690:Ptpdc1 UTSW 13 48586905 missense probably benign 0.33
R0946:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1076:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1387:Ptpdc1 UTSW 13 48586320 missense possibly damaging 0.85
R1459:Ptpdc1 UTSW 13 48586697 missense possibly damaging 0.62
R1688:Ptpdc1 UTSW 13 48586224 missense probably benign 0.28
R1732:Ptpdc1 UTSW 13 48586545 missense probably benign 0.00
R2097:Ptpdc1 UTSW 13 48592659 critical splice acceptor site probably null
R2570:Ptpdc1 UTSW 13 48586063 missense probably benign 0.02
R3950:Ptpdc1 UTSW 13 48589194 missense probably damaging 1.00
R4260:Ptpdc1 UTSW 13 48579758 missense probably benign 0.33
R5194:Ptpdc1 UTSW 13 48586789 missense possibly damaging 0.91
R5271:Ptpdc1 UTSW 13 48590698 missense probably damaging 1.00
R5894:Ptpdc1 UTSW 13 48590322 missense probably damaging 1.00
R5934:Ptpdc1 UTSW 13 48586369 missense probably benign 0.08
R6894:Ptpdc1 UTSW 13 48590638 missense probably benign 0.21
R7056:Ptpdc1 UTSW 13 48586990 missense possibly damaging 0.65
R7436:Ptpdc1 UTSW 13 48586666 missense probably benign 0.01
R7719:Ptpdc1 UTSW 13 48586290 missense probably benign 0.15
R7827:Ptpdc1 UTSW 13 48579788 missense probably damaging 1.00
R7969:Ptpdc1 UTSW 13 48587101 missense probably damaging 1.00
R7986:Ptpdc1 UTSW 13 48592570 missense probably damaging 1.00
R8330:Ptpdc1 UTSW 13 48597914 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGCACTCAGTTCAGGCTG -3'
(R):5'- TTGCTACATGCCACCAACTC -3'

Sequencing Primer
(F):5'- ACTCAGTTCAGGCTGCAGAC -3'
(R):5'- CCAGAGCTGGGTTTTAATAAGGAG -3'
Posted On2019-06-07