Incidental Mutation 'PIT4687001:Ctsr'
ID556200
Institutional Source Beutler Lab
Gene Symbol Ctsr
Ensembl Gene ENSMUSG00000055679
Gene Namecathepsin R
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61159204-61164256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61160532 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 266 (H266R)
Ref Sequence ENSEMBL: ENSMUSP00000021889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021889
AA Change: H266R

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021889
Gene: ENSMUSG00000055679
AA Change: H266R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.68e-21 SMART
Pept_C1 115 333 1.59e-111 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Ctsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Ctsr APN 13 61162742 missense probably damaging 1.00
IGL01327:Ctsr APN 13 61162675 splice site probably benign
IGL02169:Ctsr APN 13 61163240 splice site probably benign
IGL02516:Ctsr APN 13 61163178 missense probably benign
IGL02739:Ctsr APN 13 61161844 missense probably benign 0.01
R0180:Ctsr UTSW 13 61162745 missense probably damaging 1.00
R1938:Ctsr UTSW 13 61162445 missense probably benign 0.00
R2362:Ctsr UTSW 13 61162796 missense probably damaging 1.00
R3856:Ctsr UTSW 13 61161936 missense possibly damaging 0.75
R4125:Ctsr UTSW 13 61161845 missense probably benign 0.17
R4135:Ctsr UTSW 13 61161270 missense probably benign 0.15
R4903:Ctsr UTSW 13 61163131 missense probably benign 0.01
R5551:Ctsr UTSW 13 61159543 missense probably damaging 1.00
R5705:Ctsr UTSW 13 61161264 missense probably damaging 1.00
R5721:Ctsr UTSW 13 61161853 missense possibly damaging 0.84
R6132:Ctsr UTSW 13 61161768 critical splice donor site probably null
R6196:Ctsr UTSW 13 61160531 missense probably benign 0.09
R6719:Ctsr UTSW 13 61160451 missense possibly damaging 0.60
R7530:Ctsr UTSW 13 61163117 missense probably damaging 1.00
R7698:Ctsr UTSW 13 61162567 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGACTTGCAACAGGAAAATTC -3'
(R):5'- AGCACATAGACAAGTGTTTACCAAC -3'

Sequencing Primer
(F):5'- ATCCCCCTGAAATGTTAGGCAGTG -3'
(R):5'- AGACAAGTGTTTACCAACAAATAAAC -3'
Posted On2019-06-07