Incidental Mutation 'PIT4687001:Parp10'
ID556205
Institutional Source Beutler Lab
Gene Symbol Parp10
Ensembl Gene ENSMUSG00000063268
Gene Namepoly (ADP-ribose) polymerase family, member 10
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #PIT4687001 (G1)
Quality Score107.008
Status Not validated
Chromosome15
Chromosomal Location76231174-76243441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76240922 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 545 (R545Q)
Ref Sequence ENSEMBL: ENSMUSP00000075110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075689] [ENSMUST00000165738]
Predicted Effect probably benign
Transcript: ENSMUST00000075689
AA Change: R545Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000075110
Gene: ENSMUSG00000063268
AA Change: R545Q

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165738
AA Change: R545Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129765
Gene: ENSMUSG00000063268
AA Change: R545Q

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) polymerases (PARPs), such as PARP10, regulate gene transcription by altering chromatin organization by adding ADP-ribose to histones. PARPs can also function as transcriptional cofactors (Yu et al., 2005 [PubMed 15674325]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Parp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Parp10 APN 15 76241677 missense probably benign 0.09
IGL01419:Parp10 APN 15 76241388 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0126:Parp10 UTSW 15 76243066 missense probably damaging 0.98
R0207:Parp10 UTSW 15 76242633 missense probably benign 0.00
R1300:Parp10 UTSW 15 76241990 missense possibly damaging 0.93
R1412:Parp10 UTSW 15 76243084 missense probably damaging 0.99
R1510:Parp10 UTSW 15 76241417 missense probably damaging 1.00
R1670:Parp10 UTSW 15 76242070 missense probably benign 0.01
R1875:Parp10 UTSW 15 76242851 missense probably damaging 1.00
R2219:Parp10 UTSW 15 76233583 missense probably damaging 1.00
R2351:Parp10 UTSW 15 76242856 missense probably benign
R4027:Parp10 UTSW 15 76241154 critical splice donor site probably null
R4659:Parp10 UTSW 15 76242985 missense probably damaging 1.00
R4763:Parp10 UTSW 15 76233427 missense probably damaging 0.99
R4828:Parp10 UTSW 15 76243081 missense probably benign 0.00
R5066:Parp10 UTSW 15 76240946 splice site probably benign
R5090:Parp10 UTSW 15 76241725 missense probably damaging 0.97
R5495:Parp10 UTSW 15 76243166 missense probably benign
R6271:Parp10 UTSW 15 76242002 missense probably benign
R6335:Parp10 UTSW 15 76242188 missense probably benign 0.00
R6503:Parp10 UTSW 15 76242484 missense probably damaging 1.00
R6606:Parp10 UTSW 15 76240108 missense possibly damaging 0.66
R6868:Parp10 UTSW 15 76243106 missense probably damaging 1.00
R7197:Parp10 UTSW 15 76242416 missense probably damaging 1.00
X0027:Parp10 UTSW 15 76241504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGACTCCAAGGACCGG -3'
(R):5'- GAGTACGTCCTGCGGTCTTTTC -3'

Sequencing Primer
(F):5'- CTCCAAGGACCGGTGGATAG -3'
(R):5'- GTCCTGCGGTCTTTTCTTAACAATC -3'
Posted On2019-06-07