Incidental Mutation 'PIT4687001:Olfr120'
ID556207
Institutional Source Beutler Lab
Gene Symbol Olfr120
Ensembl Gene ENSMUSG00000063994
Gene Nameolfactory receptor 120
SynonymsGA_x6K02T2PSCP-2184981-2185946, MOR263-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37721808-37727220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37726191 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 56 (C56G)
Ref Sequence ENSEMBL: ENSMUSP00000146861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077498] [ENSMUST00000207771]
Predicted Effect probably benign
Transcript: ENSMUST00000077498
AA Change: C65G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000094931
Gene: ENSMUSG00000063994
AA Change: C65G

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 1e-5 PFAM
Pfam:7tm_1 56 305 6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207771
AA Change: C56G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Olfr120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr120 APN 17 37726302 missense probably benign 0.08
IGL01925:Olfr120 APN 17 37726111 missense probably benign 0.18
IGL02901:Olfr120 APN 17 37726420 missense probably damaging 1.00
R1645:Olfr120 UTSW 17 37726338 missense probably benign 0.01
R2218:Olfr120 UTSW 17 37726254 missense probably damaging 0.97
R2336:Olfr120 UTSW 17 37726798 missense probably benign 0.07
R4613:Olfr120 UTSW 17 37726696 missense probably damaging 1.00
R5237:Olfr120 UTSW 17 37726377 missense probably damaging 1.00
R5880:Olfr120 UTSW 17 37726654 missense probably benign 0.09
R6187:Olfr120 UTSW 17 37726141 missense probably damaging 0.99
Z1088:Olfr120 UTSW 17 37726092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGATGAGTGTCAACTGCTC -3'
(R):5'- CATATGGCCATGTAGCGGTC -3'

Sequencing Primer
(F):5'- CTCTCTGTGGCAGGAAAATAAGTTG -3'
(R):5'- TCAAAGGCCATAGCTGCCAGTAG -3'
Posted On2019-06-07