Incidental Mutation 'PIT4687001:Dsg1a'
ID556210
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Namedesmoglein 1 alpha
SynonymsDsg1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20310811-20343350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20331698 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 417 (A417S)
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
Predicted Effect probably benign
Transcript: ENSMUST00000077146
AA Change: A417S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: A417S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R1980:Dsg1a UTSW 18 20338650 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R2426:Dsg1a UTSW 18 20336804 missense probably damaging 0.96
R3031:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
R7018:Dsg1a UTSW 18 20328738 missense possibly damaging 0.48
R7201:Dsg1a UTSW 18 20328311 missense probably damaging 0.98
R7730:Dsg1a UTSW 18 20331711 missense possibly damaging 0.77
R7814:Dsg1a UTSW 18 20338515 splice site probably null
R8185:Dsg1a UTSW 18 20340612 missense probably damaging 1.00
R8297:Dsg1a UTSW 18 20332033 missense probably benign 0.02
R8377:Dsg1a UTSW 18 20333774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCTAGATTATGAAGCCATG -3'
(R):5'- CACACTTTGTCAAATCCACTTTGTG -3'

Sequencing Primer
(F):5'- GGAATGTAGCTGAATTCCACCAGTC -3'
(R):5'- GTCAAATCCACTTTGTGCTCATTC -3'
Posted On2019-06-07