Incidental Mutation 'PIT4508001:Cacnb2'
ID556215
Institutional Source Beutler Lab
Gene Symbol Cacnb2
Ensembl Gene ENSMUSG00000057914
Gene Namecalcium channel, voltage-dependent, beta 2 subunit
SynonymsCchb2, Cavbeta2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4508001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location14603088-14987908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14984419 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 487 (T487S)
Ref Sequence ENSEMBL: ENSMUSP00000110371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]
Predicted Effect probably benign
Transcript: ENSMUST00000114719
AA Change: T443S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: T443S

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 24 65 1.7e-26 PFAM
SH3 69 133 2.42e-2 SMART
low complexity region 149 161 N/A INTRINSIC
GuKc 232 414 6.11e-38 SMART
low complexity region 419 448 N/A INTRINSIC
low complexity region 546 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114723
AA Change: T487S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: T487S

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 68 109 2.7e-25 PFAM
SH3 113 177 2.42e-2 SMART
low complexity region 193 205 N/A INTRINSIC
GuKc 276 458 6.11e-38 SMART
low complexity region 463 492 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193522
Predicted Effect probably benign
Transcript: ENSMUST00000193800
AA Change: T437S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: T437S

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 18 59 3.2e-27 PFAM
SH3 63 127 2.42e-2 SMART
low complexity region 143 155 N/A INTRINSIC
GuKc 226 408 6.11e-38 SMART
low complexity region 413 442 N/A INTRINSIC
low complexity region 540 555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Cacnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cacnb2 APN 2 14984270 missense possibly damaging 0.95
IGL01806:Cacnb2 APN 2 14614268 missense probably damaging 1.00
IGL01939:Cacnb2 APN 2 14971569 missense probably benign 0.16
IGL02941:Cacnb2 APN 2 14958829 missense probably benign 0.00
PIT1430001:Cacnb2 UTSW 2 14971601 nonsense probably null
PIT4498001:Cacnb2 UTSW 2 14874819 nonsense probably null
R0095:Cacnb2 UTSW 2 14958775 missense probably damaging 1.00
R0731:Cacnb2 UTSW 2 14985706 missense possibly damaging 0.95
R1521:Cacnb2 UTSW 2 14614352 missense probably benign 0.18
R1829:Cacnb2 UTSW 2 14985964 missense possibly damaging 0.89
R2174:Cacnb2 UTSW 2 14958767 missense probably benign 0.21
R2471:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R2473:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R3801:Cacnb2 UTSW 2 14824263 missense possibly damaging 0.85
R3831:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3832:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3833:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3981:Cacnb2 UTSW 2 14604503 missense probably benign
R4231:Cacnb2 UTSW 2 14981440 missense probably damaging 1.00
R4426:Cacnb2 UTSW 2 14975215 nonsense probably null
R4569:Cacnb2 UTSW 2 14986000 missense possibly damaging 0.94
R4815:Cacnb2 UTSW 2 14874780 missense probably damaging 1.00
R4911:Cacnb2 UTSW 2 14981340 missense possibly damaging 0.83
R5189:Cacnb2 UTSW 2 14986038 missense possibly damaging 0.56
R6114:Cacnb2 UTSW 2 14975201 missense possibly damaging 0.88
R6158:Cacnb2 UTSW 2 14985601 missense possibly damaging 0.62
R6530:Cacnb2 UTSW 2 14975167 missense probably damaging 1.00
R6612:Cacnb2 UTSW 2 14975149 missense probably benign 0.41
R6882:Cacnb2 UTSW 2 14824299 missense probably benign 0.00
R6889:Cacnb2 UTSW 2 14986015 missense possibly damaging 0.55
R7804:Cacnb2 UTSW 2 14968037 missense probably benign 0.08
R7820:Cacnb2 UTSW 2 14960666 missense probably damaging 1.00
R7971:Cacnb2 UTSW 2 14971598 missense possibly damaging 0.51
R7980:Cacnb2 UTSW 2 14604515 missense probably benign
R7993:Cacnb2 UTSW 2 14963920 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACAGAACTTGGTCCTGGGTTG -3'
(R):5'- ACTGAGAGAACTTGGTCAGTG -3'

Sequencing Primer
(F):5'- GCGTTAATGGCCTATCTGAAATGC -3'
(R):5'- AACTTGGTCAGTGGCGCTTG -3'
Posted On2019-06-07