Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4508001:Cacnb2'

556215

Institutional Source

Beutler Lab

Gene Symbol

Cacnb2

Ensembl Gene

ENSMUSG00000057914

Gene Name

calcium channel, voltage-dependent, beta 2 subunit

Synonyms

Cchb2, Cavbeta2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4508001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14603088-14987908 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14984419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 487 (T487S)

Ref Sequence

ENSEMBL: ENSMUSP00000110371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]

AlphaFold

Q8CC27

Predicted Effect

probably benign
Transcript: ENSMUST00000114719
AA Change: T443S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: T443S

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	24	65	1.7e-26	PFAM
SH3	69	133	2.42e-2	SMART
low complexity region	149	161	N/A	INTRINSIC
GuKc	232	414	6.11e-38	SMART
low complexity region	419	448	N/A	INTRINSIC
low complexity region	546	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114723
AA Change: T487S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: T487S

Domain	Start	End	E-Value	Type
low complexity region	50	61	N/A	INTRINSIC
Pfam:VGCC_beta4Aa_N	68	109	2.7e-25	PFAM
SH3	113	177	2.42e-2	SMART
low complexity region	193	205	N/A	INTRINSIC
GuKc	276	458	6.11e-38	SMART
low complexity region	463	492	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193522

Predicted Effect

probably benign
Transcript: ENSMUST00000193800
AA Change: T437S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: T437S

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	18	59	3.2e-27	PFAM
SH3	63	127	2.42e-2	SMART
low complexity region	143	155	N/A	INTRINSIC
GuKc	226	408	6.11e-38	SMART
low complexity region	413	442	N/A	INTRINSIC
low complexity region	540	555	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 90.7%
10x: 84.6%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	T	C	16: 20,357,378	T1228A	probably damaging	Het
Actg2	A	T	6: 83,513,007	I370N	possibly damaging	Het
Ankrd36	A	G	11: 5,607,137	T330A	possibly damaging	Het
Atrip	C	T	9: 109,073,989	A6T	possibly damaging	Het
Bms1	G	A	6: 118,383,806	R1234C	probably benign	Het
Col4a3bp	T	C	13: 96,630,776	F478S	probably damaging	Het
Esco2	A	T	14: 65,831,465	V132E	probably damaging	Het
Gjb5	A	T	4: 127,356,240	L37Q	probably damaging	Het
Gm8020	T	A	14: 42,502,277	Y24F		Het
H2-Q6	T	C	17: 35,425,820	L195P	probably damaging	Het
Hc	T	C	2: 34,984,804	T1602A	probably damaging	Het
Hcrtr2	A	T	9: 76,246,380	Y243*	probably null	Het
Hist1h2bg	CTCGACCATCACGTC	CTC	13: 23,571,693		probably benign	Het
Itga3	T	C	11: 95,055,893	H730R	probably benign	Het
Kif1a	A	T	1: 93,046,729	L866Q	probably damaging	Het
Krt81	A	T	15: 101,462,725	L127Q	probably damaging	Het
Mdn1	T	C	4: 32,719,223	I2262T	probably damaging	Het
Mxd3	A	T	13: 55,325,894	D170E	probably benign	Het
Myh2	A	G	11: 67,185,505	M811V	probably benign	Het
Naa16	A	T	14: 79,369,087	D335E	probably benign	Het
Nkd1	A	G	8: 88,522,400	T58A	probably benign	Het
Ogfrl1	T	A	1: 23,370,270	R292*	probably null	Het
Olfr1136	G	A	2: 87,693,715	H56Y	probably damaging	Het
Olfr589	T	A	7: 103,155,313	M145L	probably benign	Het
Pom121l12	A	G	11: 14,599,689	R132G	possibly damaging	Het
Prss46	A	G	9: 110,851,416	K210E	probably damaging	Het
Scn8a	T	C	15: 101,029,692	Y1351H	probably damaging	Het
Shisa9	G	A	16: 12,267,480	V318I	probably benign	Het
Slc41a2	T	G	10: 83,254,880	H480P	probably damaging	Het
Slc45a1	C	A	4: 150,638,435	A331S	probably benign	Het
Smg1	A	T	7: 118,185,541	F885I	unknown	Het
Speer4f1	T	C	5: 17,480,414	S236P	unknown	Het
Zfp326	A	T	5: 105,914,690	Q475L	probably benign	Het
Zzef1	T	G	11: 72,895,176	V2058G	probably benign	Het

Other mutations in Cacnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01527:Cacnb2	APN	2	14984270	missense	possibly damaging	0.95
IGL01806:Cacnb2	APN	2	14614268	missense	probably damaging	1.00
IGL01939:Cacnb2	APN	2	14971569	missense	probably benign	0.16
IGL02941:Cacnb2	APN	2	14958829	missense	probably benign	0.00
PIT1430001:Cacnb2	UTSW	2	14971601	nonsense	probably null
PIT4498001:Cacnb2	UTSW	2	14874819	nonsense	probably null
R0095:Cacnb2	UTSW	2	14958775	missense	probably damaging	1.00
R0731:Cacnb2	UTSW	2	14985706	missense	possibly damaging	0.95
R1521:Cacnb2	UTSW	2	14614352	missense	probably benign	0.18
R1829:Cacnb2	UTSW	2	14985964	missense	possibly damaging	0.89
R2174:Cacnb2	UTSW	2	14958767	missense	probably benign	0.21
R2471:Cacnb2	UTSW	2	14984314	missense	probably damaging	1.00
R2473:Cacnb2	UTSW	2	14984314	missense	probably damaging	1.00
R3801:Cacnb2	UTSW	2	14824263	missense	possibly damaging	0.85
R3831:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3832:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3833:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3981:Cacnb2	UTSW	2	14604503	missense	probably benign
R4231:Cacnb2	UTSW	2	14981440	missense	probably damaging	1.00
R4426:Cacnb2	UTSW	2	14975215	nonsense	probably null
R4569:Cacnb2	UTSW	2	14986000	missense	possibly damaging	0.94
R4815:Cacnb2	UTSW	2	14874780	missense	probably damaging	1.00
R4911:Cacnb2	UTSW	2	14981340	missense	possibly damaging	0.83
R5189:Cacnb2	UTSW	2	14986038	missense	possibly damaging	0.56
R6114:Cacnb2	UTSW	2	14975201	missense	possibly damaging	0.88
R6158:Cacnb2	UTSW	2	14985601	missense	possibly damaging	0.62
R6530:Cacnb2	UTSW	2	14975167	missense	probably damaging	1.00
R6612:Cacnb2	UTSW	2	14975149	missense	probably benign	0.41
R6882:Cacnb2	UTSW	2	14824299	missense	probably benign	0.00
R6889:Cacnb2	UTSW	2	14986015	missense	possibly damaging	0.55
R7804:Cacnb2	UTSW	2	14968037	missense	probably benign	0.08
R7820:Cacnb2	UTSW	2	14960666	missense	probably damaging	1.00
R7971:Cacnb2	UTSW	2	14971598	missense	possibly damaging	0.51
R7980:Cacnb2	UTSW	2	14604515	missense	probably benign
R7993:Cacnb2	UTSW	2	14963920	missense	probably benign	0.16
R8762:Cacnb2	UTSW	2	14967948	missense	possibly damaging	0.71
R8868:Cacnb2	UTSW	2	14984269	missense	probably benign	0.41
R9147:Cacnb2	UTSW	2	14967962	missense	possibly damaging	0.89
R9148:Cacnb2	UTSW	2	14967962	missense	possibly damaging	0.89
R9211:Cacnb2	UTSW	2	14874497	missense	unknown
R9521:Cacnb2	UTSW	2	14604327	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGAACTTGGTCCTGGGTTG -3'
(R):5'- ACTGAGAGAACTTGGTCAGTG -3'

Sequencing Primer
(F):5'- GCGTTAATGGCCTATCTGAAATGC -3'
(R):5'- AACTTGGTCAGTGGCGCTTG -3'

Posted On

2019-06-07