Incidental Mutation 'PIT4508001:Olfr1136'
ID556217
Institutional Source Beutler Lab
Gene Symbol Olfr1136
Ensembl Gene ENSMUSG00000075151
Gene Nameolfactory receptor 1136
SynonymsMOR177-3, GA_x6K02T2Q125-49193051-49192119
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #PIT4508001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87692881-87693947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87693715 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 56 (H56Y)
Ref Sequence ENSEMBL: ENSMUSP00000076681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471]
Predicted Effect probably damaging
Transcript: ENSMUST00000077471
AA Change: H56Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: H56Y

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Olfr1136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01809:Olfr1136 APN 2 87693745 missense possibly damaging 0.73
IGL02190:Olfr1136 APN 2 87693063 missense probably benign 0.21
IGL02902:Olfr1136 APN 2 87693000 missense probably damaging 1.00
R0153:Olfr1136 UTSW 2 87693604 missense probably benign 0.05
R0665:Olfr1136 UTSW 2 87693808 missense probably benign 0.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1518:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R1812:Olfr1136 UTSW 2 87693103 missense probably benign 0.01
R1993:Olfr1136 UTSW 2 87693433 missense probably benign 0.07
R2098:Olfr1136 UTSW 2 87693729 missense probably benign 0.25
R3106:Olfr1136 UTSW 2 87693505 missense probably damaging 0.98
R4622:Olfr1136 UTSW 2 87693643 nonsense probably null
R4694:Olfr1136 UTSW 2 87693760 missense probably benign 0.03
R5079:Olfr1136 UTSW 2 87693208 missense probably damaging 0.99
R5474:Olfr1136 UTSW 2 87693057 missense probably damaging 1.00
R6432:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R6667:Olfr1136 UTSW 2 87693570 missense probably benign 0.00
R7519:Olfr1136 UTSW 2 87693409 missense probably benign 0.01
R7652:Olfr1136 UTSW 2 87693360 missense probably damaging 1.00
R7657:Olfr1136 UTSW 2 87692992 missense probably damaging 0.99
R8230:Olfr1136 UTSW 2 87693361 missense probably damaging 1.00
R8439:Olfr1136 UTSW 2 87693744 missense probably damaging 1.00
Z1176:Olfr1136 UTSW 2 87693151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATCAAAGGCCATCACCG -3'
(R):5'- TCAAACCCTAAGAGACCTTTGTC -3'

Sequencing Primer
(F):5'- TCACCGCCAGCAGCATG -3'
(R):5'- TTTAGATCATGAACAGAGAAGAATGG -3'
Posted On2019-06-07