Incidental Mutation 'PIT4508001:Gjb5'
ID556219
Institutional Source Beutler Lab
Gene Symbol Gjb5
Ensembl Gene ENSMUSG00000042357
Gene Namegap junction protein, beta 5
Synonymsconnexin 31.1, Gjb-5, Cx31.1, Cnx31.1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #PIT4508001 (G1)
Quality Score119.008
Status Not validated
Chromosome4
Chromosomal Location127354809-127358181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127356240 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 37 (L37Q)
Ref Sequence ENSEMBL: ENSMUSP00000045325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046498] [ENSMUST00000060419] [ENSMUST00000106090]
Predicted Effect probably damaging
Transcript: ENSMUST00000046498
AA Change: L37Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045325
Gene: ENSMUSG00000042357
AA Change: L37Q

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
CNX 42 75 1.99e-19 SMART
Connexin_CCC 139 206 1.42e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060419
SMART Domains Protein: ENSMUSP00000053307
Gene: ENSMUSG00000046623

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 9.16e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 208 6.28e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106090
SMART Domains Protein: ENSMUSP00000101696
Gene: ENSMUSG00000046623

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 9.16e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 208 6.28e-35 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-type (group I) connexin family. The encoded protein is a gap junction protein involved in intercellular communication related to epidermal differentiation and environmental sensing. This gene has been linked to non-small cell lung cancer. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, reduced weight and reduced placental development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Gjb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Gjb5 APN 4 127355562 missense probably benign 0.03
IGL03376:Gjb5 APN 4 127356255 missense probably damaging 1.00
R2090:Gjb5 UTSW 4 127356001 missense probably benign 0.01
R2197:Gjb5 UTSW 4 127356270 splice site probably null
R4968:Gjb5 UTSW 4 127356222 missense probably damaging 1.00
R5419:Gjb5 UTSW 4 127355859 missense probably benign
R5494:Gjb5 UTSW 4 127355554 missense probably damaging 0.99
R5664:Gjb5 UTSW 4 127355929 missense probably benign 0.00
R5806:Gjb5 UTSW 4 127355925 missense probably benign
R6369:Gjb5 UTSW 4 127355930 missense possibly damaging 0.58
R6408:Gjb5 UTSW 4 127356147 missense probably benign 0.24
R7747:Gjb5 UTSW 4 127356162 missense probably damaging 1.00
R8488:Gjb5 UTSW 4 127356285 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCGGGTAAAGGTAACCTTCAC -3'
(R):5'- AAGTTCTCAAGCTGAGCACCC -3'

Sequencing Primer
(F):5'- TTCGATAGGCCACATGCATG -3'
(R):5'- TGAGCACCCCCTAACGTG -3'
Posted On2019-06-07