Incidental Mutation 'PIT4508001:Slc45a1'
ID556220
Institutional Source Beutler Lab
Gene Symbol Slc45a1
Ensembl Gene ENSMUSG00000039838
Gene Namesolute carrier family 45, member 1
SynonymsDnb5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #PIT4508001 (G1)
Quality Score121.008
Status Not validated
Chromosome4
Chromosomal Location150628572-150652174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 150638435 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 331 (A331S)
Ref Sequence ENSEMBL: ENSMUSP00000036774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037827] [ENSMUST00000117997]
Predicted Effect probably benign
Transcript: ENSMUST00000037827
AA Change: A331S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036774
Gene: ENSMUSG00000039838
AA Change: A331S

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 86 310 7.3e-11 PFAM
Pfam:MFS_1 92 356 1.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 680 702 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117997
AA Change: A331S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112737
Gene: ENSMUSG00000039838
AA Change: A331S

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 87 307 1.6e-12 PFAM
Pfam:MFS_1 92 362 2.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was isolated initially from a region on chromosome 1p that is frequently deleted in human neuroblastoma, although no causal relationship has since been demonstrated. The encoded protein belongs to the glycoside-pentoside-hexuronide cation symporter transporter family and may play a role in glucose uptake. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Slc45a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Slc45a1 APN 4 150643969 missense probably damaging 1.00
IGL02009:Slc45a1 APN 4 150637990 missense probably damaging 1.00
IGL02251:Slc45a1 APN 4 150638719 splice site probably benign
IGL02752:Slc45a1 APN 4 150638021 missense probably benign 0.01
IGL02881:Slc45a1 APN 4 150638530 missense probably benign 0.36
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0449:Slc45a1 UTSW 4 150643305 missense probably damaging 1.00
R0756:Slc45a1 UTSW 4 150642597 frame shift probably null
R1435:Slc45a1 UTSW 4 150644048 missense probably damaging 1.00
R1837:Slc45a1 UTSW 4 150638459 missense probably benign 0.00
R1943:Slc45a1 UTSW 4 150644277 missense probably benign 0.02
R2186:Slc45a1 UTSW 4 150638251 missense probably benign 0.01
R3766:Slc45a1 UTSW 4 150638060 missense probably damaging 1.00
R4689:Slc45a1 UTSW 4 150638539 missense probably benign 0.31
R4697:Slc45a1 UTSW 4 150638284 missense probably damaging 1.00
R4709:Slc45a1 UTSW 4 150638240 missense probably benign 0.04
R5253:Slc45a1 UTSW 4 150638270 missense probably damaging 0.98
R5387:Slc45a1 UTSW 4 150643909 intron probably benign
R5914:Slc45a1 UTSW 4 150629540 missense possibly damaging 0.57
R6259:Slc45a1 UTSW 4 150638360 missense possibly damaging 0.63
R6290:Slc45a1 UTSW 4 150642639 missense probably damaging 1.00
R6961:Slc45a1 UTSW 4 150629653 missense probably damaging 0.99
R6981:Slc45a1 UTSW 4 150638594 missense possibly damaging 0.48
R7099:Slc45a1 UTSW 4 150629573 missense probably benign 0.00
R7209:Slc45a1 UTSW 4 150635212 intron probably null
R7601:Slc45a1 UTSW 4 150629537 missense possibly damaging 0.78
R7615:Slc45a1 UTSW 4 150638545 missense probably benign 0.01
R7730:Slc45a1 UTSW 4 150630940 missense probably damaging 1.00
R7750:Slc45a1 UTSW 4 150644041 missense probably damaging 1.00
X0026:Slc45a1 UTSW 4 150644050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTGACACTGATGGCCTG -3'
(R):5'- TAACCCTGAGTGTCACCACC -3'

Sequencing Primer
(F):5'- AAGTAATTGTCATGGCCCGC -3'
(R):5'- ACCGTGCTCACCCTGATTAG -3'
Posted On2019-06-07