Incidental Mutation 'PIT4508001:Actg2'
ID556223
Institutional Source Beutler Lab
Gene Symbol Actg2
Ensembl Gene ENSMUSG00000059430
Gene Nameactin, gamma 2, smooth muscle, enteric
SynonymsAct4, Act-4, ACTA3, SMGA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4508001 (G1)
Quality Score122.008
Status Not validated
Chromosome6
Chromosomal Location83512905-83536265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83513007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 370 (I370N)
Ref Sequence ENSEMBL: ENSMUSP00000074658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075161] [ENSMUST00000121731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075161
AA Change: I370N

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074658
Gene: ENSMUSG00000059430
AA Change: I370N

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121731
AA Change: I370N

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113552
Gene: ENSMUSG00000059430
AA Change: I370N

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Actg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Actg2 APN 6 83523175 missense probably damaging 1.00
R0309:Actg2 UTSW 6 83519914 missense probably damaging 1.00
R0319:Actg2 UTSW 6 83520743 missense probably damaging 1.00
R1253:Actg2 UTSW 6 83522887 missense probably damaging 1.00
R1619:Actg2 UTSW 6 83523187 missense probably damaging 1.00
R1677:Actg2 UTSW 6 83522819 missense possibly damaging 0.92
R2512:Actg2 UTSW 6 83526847 missense probably damaging 1.00
R4127:Actg2 UTSW 6 83522884 missense possibly damaging 0.86
R4195:Actg2 UTSW 6 83523173 missense probably damaging 1.00
R5165:Actg2 UTSW 6 83526832 missense probably benign 0.22
R5661:Actg2 UTSW 6 83520772 missense probably damaging 0.98
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6707:Actg2 UTSW 6 83513094 nonsense probably null
R7069:Actg2 UTSW 6 83520763 missense probably damaging 1.00
R7763:Actg2 UTSW 6 83527368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAAAATCCCTTAGCATTGTCTGTG -3'
(R):5'- TTGAAGCTCCCCAGTATCTGAG -3'

Sequencing Primer
(F):5'- TGAGACACACATGTAGGAGCATCC -3'
(R):5'- TCCCCAGTATCTGAGATCATAGCATG -3'
Posted On2019-06-07