Incidental Mutation 'PIT4508001:Nkd1'
ID556227
Institutional Source Beutler Lab
Gene Symbol Nkd1
Ensembl Gene ENSMUSG00000031661
Gene Namenaked cuticle 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #PIT4508001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location88521354-88594884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88522400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 58 (T58A)
Ref Sequence ENSEMBL: ENSMUSP00000034086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034086]
Predicted Effect probably benign
Transcript: ENSMUST00000034086
AA Change: T58A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034086
Gene: ENSMUSG00000031661
AA Change: T58A

DomainStartEndE-ValueType
SCOP:d2pvba_ 121 164 1e-3 SMART
low complexity region 379 397 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the mouse, Nkd is a Dishevelled (see DVL1; MIM 601365)-binding protein that functions as a negative regulator of the Wnt (see WNT1; MIM 164820)-beta-catenin (see MIM 116806)-Tcf (see MIM 602272) signaling pathway.[supplied by OMIM, Jun 2003]
PHENOTYPE: Homozygous null mice display reduced male fertility with oligozoospermia, small testis, and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Nkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Nkd1 APN 8 88591552 splice site probably benign
IGL01724:Nkd1 APN 8 88522295 missense probably damaging 0.98
IGL03297:Nkd1 APN 8 88574274 splice site probably benign
R0350:Nkd1 UTSW 8 88585216 nonsense probably null
R0611:Nkd1 UTSW 8 88522316 missense probably damaging 1.00
R1080:Nkd1 UTSW 8 88592019 missense probably benign 0.02
R1946:Nkd1 UTSW 8 88592117 missense probably damaging 1.00
R2036:Nkd1 UTSW 8 88591677 missense probably damaging 0.99
R2135:Nkd1 UTSW 8 88591650 missense probably benign 0.06
R4623:Nkd1 UTSW 8 88589755 missense probably benign 0.35
R5254:Nkd1 UTSW 8 88589194 missense probably damaging 1.00
R6057:Nkd1 UTSW 8 88589814 critical splice donor site probably null
R6168:Nkd1 UTSW 8 88585231 missense probably damaging 1.00
R7424:Nkd1 UTSW 8 88585175 missense probably benign 0.13
X0024:Nkd1 UTSW 8 88592135 missense probably damaging 1.00
Z1177:Nkd1 UTSW 8 88592051 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCTTTACTCTCCGGGCTG -3'
(R):5'- CAAGGGTCCTCCAAAGCATAG -3'

Sequencing Primer
(F):5'- GGCTGTGCCGCCTTGTC -3'
(R):5'- GCATAGGGCACAAGTAGGG -3'
Posted On2019-06-07