Incidental Mutation 'PIT4508001:Atrip'
ID556229
Institutional Source Beutler Lab
Gene Symbol Atrip
Ensembl Gene ENSMUSG00000025646
Gene NameATR interacting protein
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4508001 (G1)
Quality Score131.008
Status Not validated
Chromosome9
Chromosomal Location109057933-109074124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109073989 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 6 (A6T)
Ref Sequence ENSEMBL: ENSMUSP00000044831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045011] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000167504] [ENSMUST00000192801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045011
AA Change: A6T

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646
AA Change: A6T

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160217
AA Change: A6T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646
AA Change: A6T

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161521
AA Change: A6T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646
AA Change: A6T

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167504
SMART Domains Protein: ENSMUSP00000133026
Gene: ENSMUSG00000091537

DomainStartEndE-ValueType
Pfam:TMA7 3 64 4.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192801
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Atrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Atrip APN 9 109069295 missense probably damaging 1.00
IGL02176:Atrip APN 9 109067046 missense probably benign 0.06
IGL02227:Atrip APN 9 109061664 missense possibly damaging 0.86
IGL02344:Atrip APN 9 109072624 nonsense probably null
IGL02406:Atrip APN 9 109065419 missense probably damaging 0.99
IGL02457:Atrip APN 9 109065231 missense possibly damaging 0.95
IGL02823:Atrip APN 9 109061178 missense probably damaging 1.00
R0637:Atrip UTSW 9 109061173 missense possibly damaging 0.58
R0709:Atrip UTSW 9 109067103 missense probably benign 0.00
R1452:Atrip UTSW 9 109072659 missense probably damaging 1.00
R1944:Atrip UTSW 9 109071867 missense probably damaging 1.00
R1945:Atrip UTSW 9 109071867 missense probably damaging 1.00
R2081:Atrip UTSW 9 109072739 critical splice acceptor site probably null
R4588:Atrip UTSW 9 109060279 missense probably damaging 1.00
R5032:Atrip UTSW 9 109065203 missense probably benign 0.02
R5088:Atrip UTSW 9 109059896 missense probably damaging 0.97
R5696:Atrip UTSW 9 109065501 missense possibly damaging 0.59
R6104:Atrip UTSW 9 109065564 missense possibly damaging 0.94
R6136:Atrip UTSW 9 109071736 missense probably damaging 1.00
R7071:Atrip UTSW 9 109067014 splice site probably null
R7131:Atrip UTSW 9 109060420 missense probably benign
R7467:Atrip UTSW 9 109069354 missense probably damaging 1.00
R7734:Atrip UTSW 9 109065506 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTCGAGTTCCTCTAGGTCG -3'
(R):5'- TTCGTACTGAGCCCAGACAC -3'

Sequencing Primer
(F):5'- AGGTCGTCCGCAGTAAATTC -3'
(R):5'- GTACACGTCACCCATCTGTG -3'
Posted On2019-06-07