Incidental Mutation 'R0605:Tsc1'
ID 55623
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Name TSC complex subunit 1
Synonyms tuberous sclerosis 1, hamartin
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0605 (G1)
Quality Score 168
Status Validated
Chromosome 2
Chromosomal Location 28531240-28581179 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28561790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 309 (S309F)
Ref Sequence ENSEMBL: ENSMUSP00000109501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565] [ENSMUST00000156857]
AlphaFold Q9EP53
Predicted Effect probably damaging
Transcript: ENSMUST00000028155
AA Change: S309F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812
AA Change: S309F

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113867
AA Change: S309F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812
AA Change: S309F

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113869
AA Change: S309F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812
AA Change: S309F

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113870
AA Change: S309F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812
AA Change: S309F

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125715
Predicted Effect probably damaging
Transcript: ENSMUST00000133565
AA Change: S309F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812
AA Change: S309F

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153625
Predicted Effect possibly damaging
Transcript: ENSMUST00000156857
AA Change: S309F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115380
Gene: ENSMUSG00000026812
AA Change: S309F

DomainStartEndE-ValueType
Pfam:Hamartin 2 348 2.3e-170 PFAM
Meta Mutation Damage Score 0.3361 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28,551,623 (GRCm39) missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28,555,023 (GRCm39) missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28,555,023 (GRCm39) missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28,562,478 (GRCm39) missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28,560,952 (GRCm39) nonsense probably null
IGL01808:Tsc1 APN 2 28,552,519 (GRCm39) missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28,553,607 (GRCm39) missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28,571,270 (GRCm39) missense probably damaging 1.00
Cassava UTSW 2 28,561,898 (GRCm39) splice site probably null
R0077:Tsc1 UTSW 2 28,568,955 (GRCm39) splice site probably benign
R0149:Tsc1 UTSW 2 28,560,913 (GRCm39) missense probably damaging 0.99
R0737:Tsc1 UTSW 2 28,560,942 (GRCm39) missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28,555,638 (GRCm39) missense probably damaging 1.00
R1751:Tsc1 UTSW 2 28,566,038 (GRCm39) missense probably damaging 0.97
R1757:Tsc1 UTSW 2 28,576,125 (GRCm39) missense probably benign 0.05
R1807:Tsc1 UTSW 2 28,576,125 (GRCm39) missense probably benign 0.05
R2014:Tsc1 UTSW 2 28,555,649 (GRCm39) splice site probably benign
R2284:Tsc1 UTSW 2 28,555,109 (GRCm39) missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28,577,154 (GRCm39) missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28,560,937 (GRCm39) missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28,562,419 (GRCm39) missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28,569,093 (GRCm39) missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28,551,702 (GRCm39) splice site probably null
R4906:Tsc1 UTSW 2 28,565,201 (GRCm39) missense possibly damaging 0.81
R5020:Tsc1 UTSW 2 28,566,531 (GRCm39) missense probably damaging 1.00
R5401:Tsc1 UTSW 2 28,576,920 (GRCm39) nonsense probably null
R5708:Tsc1 UTSW 2 28,555,197 (GRCm39) intron probably benign
R6435:Tsc1 UTSW 2 28,566,464 (GRCm39) missense probably benign 0.08
R6469:Tsc1 UTSW 2 28,561,898 (GRCm39) splice site probably null
R6502:Tsc1 UTSW 2 28,555,613 (GRCm39) missense probably damaging 1.00
R6617:Tsc1 UTSW 2 28,577,001 (GRCm39) missense possibly damaging 0.82
R7098:Tsc1 UTSW 2 28,565,744 (GRCm39) missense probably benign 0.00
R7503:Tsc1 UTSW 2 28,577,088 (GRCm39) missense possibly damaging 0.50
R7608:Tsc1 UTSW 2 28,548,748 (GRCm39) missense probably benign 0.01
R7677:Tsc1 UTSW 2 28,562,829 (GRCm39) missense probably benign 0.11
R7791:Tsc1 UTSW 2 28,571,960 (GRCm39) missense probably damaging 1.00
R8021:Tsc1 UTSW 2 28,576,901 (GRCm39) missense possibly damaging 0.67
R8203:Tsc1 UTSW 2 28,563,007 (GRCm39) splice site probably null
R8228:Tsc1 UTSW 2 28,566,141 (GRCm39) missense probably benign 0.23
R9057:Tsc1 UTSW 2 28,575,874 (GRCm39) missense probably damaging 1.00
R9088:Tsc1 UTSW 2 28,552,617 (GRCm39) missense possibly damaging 0.94
R9201:Tsc1 UTSW 2 28,576,791 (GRCm39) missense probably benign
R9386:Tsc1 UTSW 2 28,561,858 (GRCm39) missense probably benign
R9731:Tsc1 UTSW 2 28,566,486 (GRCm39) missense probably benign 0.00
R9780:Tsc1 UTSW 2 28,565,761 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTTGTTCCCAGGGATGGCTAGG -3'
(R):5'- CGCGAGACAAGTTGCATTTCAGG -3'

Sequencing Primer
(F):5'- CTAGGAGCCAACGGTTTTAAGC -3'
(R):5'- GGGTCCTCCTGAAACTTACACTG -3'
Posted On 2013-07-11