Incidental Mutation 'PIT4508001:Prss46'
ID556230
Institutional Source Beutler Lab
Gene Symbol Prss46
Ensembl Gene ENSMUSG00000049719
Gene Nameprotease, serine 46
Synonyms1700112C13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #PIT4508001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110844506-110856522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110851416 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 210 (K210E)
Ref Sequence ENSEMBL: ENSMUSP00000135787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119427] [ENSMUST00000176403]
Predicted Effect probably damaging
Transcript: ENSMUST00000119427
AA Change: K207E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112855
Gene: ENSMUSG00000049719
AA Change: K207E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 40 273 1.62e-60 SMART
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176403
AA Change: K210E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135787
Gene: ENSMUSG00000049719
AA Change: K210E

DomainStartEndE-ValueType
Tryp_SPc 43 276 1.62e-60 SMART
transmembrane domain 291 313 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Prss46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03324:Prss46 APN 9 110849679 missense probably benign 0.01
PIT4677001:Prss46 UTSW 9 110856030 missense probably benign 0.00
R0013:Prss46 UTSW 9 110850055 missense probably damaging 0.96
R0013:Prss46 UTSW 9 110850055 missense probably damaging 0.96
R0827:Prss46 UTSW 9 110851432 missense probably benign 0.21
R1521:Prss46 UTSW 9 110849635 missense probably benign 0.00
R1532:Prss46 UTSW 9 110850168 missense probably benign 0.00
R4888:Prss46 UTSW 9 110844550 start codon destroyed possibly damaging 0.75
R5201:Prss46 UTSW 9 110851475 nonsense probably null
R5246:Prss46 UTSW 9 110850034 missense probably damaging 1.00
R7196:Prss46 UTSW 9 110851465 missense probably benign 0.38
R7446:Prss46 UTSW 9 110850121 missense probably damaging 1.00
R7699:Prss46 UTSW 9 110849554 missense probably benign 0.00
R7704:Prss46 UTSW 9 110849997 missense probably damaging 1.00
R7938:Prss46 UTSW 9 110851432 missense probably benign 0.21
R8005:Prss46 UTSW 9 110856076 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAACAGCTCAGGACATGAC -3'
(R):5'- GTCACATGCAAAAGAAAGTTAAGCC -3'

Sequencing Primer
(F):5'- CTCAGGACATGACGGCAG -3'
(R):5'- GACCTGAGAATGTTGCACAC -3'
Posted On2019-06-07