Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4508001:Itga3'

556236

Institutional Source

Beutler Lab

Gene Symbol

Itga3

Ensembl Gene

ENSMUSG00000001507

Gene Name

integrin alpha 3

Synonyms

VLA-3 alpha 3, alpha3-integrin

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4508001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95044474-95076801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95055893 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 730 (H730R)

Ref Sequence

ENSEMBL: ENSMUSP00000113556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]

Predicted Effect

probably benign
Transcript: ENSMUST00000001548
AA Change: H730R

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507
AA Change: H730R

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	7e-54	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107739
AA Change: H699R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507
AA Change: H699R

Domain	Start	End	E-Value	Type
Int_alpha	20	79	1.05e2	SMART
Int_alpha	215	269	5.01e0	SMART
Int_alpha	273	330	3.07e-14	SMART
Int_alpha	335	388	4.17e-16	SMART
Int_alpha	396	452	7.57e1	SMART
low complexity region	490	503	N/A	INTRINSIC
low complexity region	775	789	N/A	INTRINSIC
transmembrane domain	963	985	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120375
AA Change: H730R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507
AA Change: H730R

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	2e-53	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 90.7%
10x: 84.6%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	T	C	16: 20,357,378	T1228A	probably damaging	Het
Actg2	A	T	6: 83,513,007	I370N	possibly damaging	Het
Ankrd36	A	G	11: 5,607,137	T330A	possibly damaging	Het
Atrip	C	T	9: 109,073,989	A6T	possibly damaging	Het
Bms1	G	A	6: 118,383,806	R1234C	probably benign	Het
Cacnb2	A	T	2: 14,984,419	T487S	probably benign	Het
Col4a3bp	T	C	13: 96,630,776	F478S	probably damaging	Het
Esco2	A	T	14: 65,831,465	V132E	probably damaging	Het
Gjb5	A	T	4: 127,356,240	L37Q	probably damaging	Het
Gm8020	T	A	14: 42,502,277	Y24F		Het
H2-Q6	T	C	17: 35,425,820	L195P	probably damaging	Het
Hc	T	C	2: 34,984,804	T1602A	probably damaging	Het
Hcrtr2	A	T	9: 76,246,380	Y243*	probably null	Het
Hist1h2bg	CTCGACCATCACGTC	CTC	13: 23,571,693		probably benign	Het
Kif1a	A	T	1: 93,046,729	L866Q	probably damaging	Het
Krt81	A	T	15: 101,462,725	L127Q	probably damaging	Het
Mdn1	T	C	4: 32,719,223	I2262T	probably damaging	Het
Mxd3	A	T	13: 55,325,894	D170E	probably benign	Het
Myh2	A	G	11: 67,185,505	M811V	probably benign	Het
Naa16	A	T	14: 79,369,087	D335E	probably benign	Het
Nkd1	A	G	8: 88,522,400	T58A	probably benign	Het
Ogfrl1	T	A	1: 23,370,270	R292*	probably null	Het
Olfr1136	G	A	2: 87,693,715	H56Y	probably damaging	Het
Olfr589	T	A	7: 103,155,313	M145L	probably benign	Het
Pom121l12	A	G	11: 14,599,689	R132G	possibly damaging	Het
Prss46	A	G	9: 110,851,416	K210E	probably damaging	Het
Scn8a	T	C	15: 101,029,692	Y1351H	probably damaging	Het
Shisa9	G	A	16: 12,267,480	V318I	probably benign	Het
Slc41a2	T	G	10: 83,254,880	H480P	probably damaging	Het
Slc45a1	C	A	4: 150,638,435	A331S	probably benign	Het
Smg1	A	T	7: 118,185,541	F885I	unknown	Het
Speer4f1	T	C	5: 17,480,414	S236P	unknown	Het
Zfp326	A	T	5: 105,914,690	Q475L	probably benign	Het
Zzef1	T	G	11: 72,895,176	V2058G	probably benign	Het

Other mutations in Itga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Itga3	APN	11	95065886	missense	probably damaging	1.00
IGL02020:Itga3	APN	11	95057390	missense	probably benign	0.02
IGL02413:Itga3	APN	11	95068771	missense	probably damaging	1.00
IGL02562:Itga3	APN	11	95068793	missense	probably benign	0.02
R0485:Itga3	UTSW	11	95061970	missense	probably benign	0.05
R1548:Itga3	UTSW	11	95046919	critical splice donor site	probably null
R1677:Itga3	UTSW	11	95055759	missense	probably damaging	0.96
R2062:Itga3	UTSW	11	95054076	missense	possibly damaging	0.92
R2088:Itga3	UTSW	11	95052494	missense	probably benign	0.10
R2679:Itga3	UTSW	11	95068310	splice site	probably benign
R3697:Itga3	UTSW	11	95062725	missense	probably benign	0.00
R3839:Itga3	UTSW	11	95057269	critical splice donor site	probably null
R4210:Itga3	UTSW	11	95062623	missense	probably benign	0.00
R4533:Itga3	UTSW	11	95057293	missense	probably benign	0.15
R4849:Itga3	UTSW	11	95076271	missense	probably benign
R4863:Itga3	UTSW	11	95061967	missense	probably damaging	1.00
R4889:Itga3	UTSW	11	95068301	missense	probably benign	0.13
R5218:Itga3	UTSW	11	95062748	missense	probably benign	0.01
R6046:Itga3	UTSW	11	95062715	missense	probably benign	0.28
R6087:Itga3	UTSW	11	95052443	critical splice donor site	probably null
R6210:Itga3	UTSW	11	95068891	intron	probably benign
R6341:Itga3	UTSW	11	95055851	splice site	probably null
R6666:Itga3	UTSW	11	95065826	missense	probably benign	0.00
R6998:Itga3	UTSW	11	95051462	missense	probably benign	0.00
R7106:Itga3	UTSW	11	95055873	missense	probably benign	0.00
R7164:Itga3	UTSW	11	95052479	missense	possibly damaging	0.85
R7267:Itga3	UTSW	11	95076362	intron	probably benign
R7421:Itga3	UTSW	11	95068855	missense	probably benign	0.20
R7514:Itga3	UTSW	11	95065896	nonsense	probably null
R7533:Itga3	UTSW	11	95046518	missense	probably benign	0.45
R7736:Itga3	UTSW	11	95076203	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGCAAAGTCAGGAGTACG -3'
(R):5'- ATCTGATGTACCATCCTAACTTACC -3'

Sequencing Primer
(F):5'- AGTACGGGCTGCAAGTTGTCC -3'
(R):5'- TGCAACGATGTCCAGTGATC -3'

Posted On

2019-06-07