Incidental Mutation 'PIT4508001:Hist1h2bg'
ID556237
Institutional Source Beutler Lab
Gene Symbol Hist1h2bg
Ensembl Gene ENSMUSG00000058385
Gene Namehistone cluster 1, H2bg
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4508001 (G1)
Quality Score217.468
Status Not validated
Chromosome13
Chromosomal Location23571396-23572013 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CTCGACCATCACGTC to CTC at 23571693 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079251] [ENSMUST00000090776] [ENSMUST00000102969] [ENSMUST00000105105] [ENSMUST00000105106]
Predicted Effect probably benign
Transcript: ENSMUST00000079251
SMART Domains Protein: ENSMUSP00000078239
Gene: ENSMUSG00000058385

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090776
SMART Domains Protein: ENSMUSP00000088281
Gene: ENSMUSG00000071478

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102969
SMART Domains Protein: ENSMUSP00000100034
Gene: ENSMUSG00000069272

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105105
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105106
SMART Domains Protein: ENSMUSP00000100738
Gene: ENSMUSG00000069268

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Hist1h2bg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Hist1h2bg APN 13 23571435 start codon destroyed probably null
IGL02256:Hist1h2bg APN 13 23571435 start codon destroyed probably null
IGL02258:Hist1h2bg APN 13 23571435 start codon destroyed probably null
R3625:Hist1h2bg UTSW 13 23571451 unclassified probably benign
R7295:Hist1h2bg UTSW 13 23571769 missense probably benign 0.44
R7506:Hist1h2bg UTSW 13 23571484 missense unknown
R8050:Hist1h2bg UTSW 13 23571667 missense probably damaging 1.00
R8499:Hist1h2bg UTSW 13 23571706 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGTTTCTACCATGCCCGAGC -3'
(R):5'- CAGTATGGGTGGCTCTGAAAAG -3'

Sequencing Primer
(F):5'- TCCAAGAAGGCCGTGACC -3'
(R):5'- CTCTGAAAAGAGCCTTTGGGTTAG -3'
Posted On2019-06-07