Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4508001:Hist1h2bg'

556237

Institutional Source

Beutler Lab

Gene Symbol

Hist1h2bg

Ensembl Gene

ENSMUSG00000058385

Gene Name

histone cluster 1, H2bg

Synonyms

Accession Numbers

Is this an essential gene?

Not available question?

Stock #

PIT4508001 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

23571396-23572013 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

CTCGACCATCACGTC to CTC at 23571693 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000100738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079251] [ENSMUST00000090776] [ENSMUST00000102969] [ENSMUST00000105105] [ENSMUST00000105106]

Predicted Effect

probably benign
Transcript: ENSMUST00000079251

SMART Domains

Protein: ENSMUSP00000078239
Gene: ENSMUSG00000058385

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
H2B	28	124	1.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090776

SMART Domains

Protein: ENSMUSP00000088281
Gene: ENSMUSG00000071478

Domain	Start	End	E-Value	Type
H2A	3	123	8.07e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102969

SMART Domains

Protein: ENSMUSP00000100034
Gene: ENSMUSG00000069272

Domain	Start	End	E-Value	Type
H2A	3	123	8.07e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105105

SMART Domains

Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

Domain	Start	End	E-Value	Type
H3	34	136	2.12e-75	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105106

SMART Domains

Protein: ENSMUSP00000100738
Gene: ENSMUSG00000069268

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
H2B	28	124	4.64e-72	SMART

Coding Region Coverage

1x: 93.4%
3x: 90.7%
10x: 84.6%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	T	C	16: 20,357,378	T1228A	probably damaging	Het
Actg2	A	T	6: 83,513,007	I370N	possibly damaging	Het
Ankrd36	A	G	11: 5,607,137	T330A	possibly damaging	Het
Atrip	C	T	9: 109,073,989	A6T	possibly damaging	Het
Bms1	G	A	6: 118,383,806	R1234C	probably benign	Het
Cacnb2	A	T	2: 14,984,419	T487S	probably benign	Het
Col4a3bp	T	C	13: 96,630,776	F478S	probably damaging	Het
Esco2	A	T	14: 65,831,465	V132E	probably damaging	Het
Gjb5	A	T	4: 127,356,240	L37Q	probably damaging	Het
Gm8020	T	A	14: 42,502,277	Y24F		Het
H2-Q6	T	C	17: 35,425,820	L195P	probably damaging	Het
Hc	T	C	2: 34,984,804	T1602A	probably damaging	Het
Hcrtr2	A	T	9: 76,246,380	Y243*	probably null	Het
Itga3	T	C	11: 95,055,893	H730R	probably benign	Het
Kif1a	A	T	1: 93,046,729	L866Q	probably damaging	Het
Krt81	A	T	15: 101,462,725	L127Q	probably damaging	Het
Mdn1	T	C	4: 32,719,223	I2262T	probably damaging	Het
Mxd3	A	T	13: 55,325,894	D170E	probably benign	Het
Myh2	A	G	11: 67,185,505	M811V	probably benign	Het
Naa16	A	T	14: 79,369,087	D335E	probably benign	Het
Nkd1	A	G	8: 88,522,400	T58A	probably benign	Het
Ogfrl1	T	A	1: 23,370,270	R292*	probably null	Het
Olfr1136	G	A	2: 87,693,715	H56Y	probably damaging	Het
Olfr589	T	A	7: 103,155,313	M145L	probably benign	Het
Pom121l12	A	G	11: 14,599,689	R132G	possibly damaging	Het
Prss46	A	G	9: 110,851,416	K210E	probably damaging	Het
Scn8a	T	C	15: 101,029,692	Y1351H	probably damaging	Het
Shisa9	G	A	16: 12,267,480	V318I	probably benign	Het
Slc41a2	T	G	10: 83,254,880	H480P	probably damaging	Het
Slc45a1	C	A	4: 150,638,435	A331S	probably benign	Het
Smg1	A	T	7: 118,185,541	F885I	unknown	Het
Speer4f1	T	C	5: 17,480,414	S236P	unknown	Het
Zfp326	A	T	5: 105,914,690	Q475L	probably benign	Het
Zzef1	T	G	11: 72,895,176	V2058G	probably benign	Het

Other mutations in Hist1h2bg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02254:Hist1h2bg	APN	13	23571435	start codon destroyed	probably null
IGL02256:Hist1h2bg	APN	13	23571435	start codon destroyed	probably null
IGL02258:Hist1h2bg	APN	13	23571435	start codon destroyed	probably null
R3625:Hist1h2bg	UTSW	13	23571451	unclassified	probably benign
R7295:Hist1h2bg	UTSW	13	23571769	missense	probably benign	0.44
R7506:Hist1h2bg	UTSW	13	23571484	missense	unknown
R8050:Hist1h2bg	UTSW	13	23571667	missense	probably damaging	1.00
R8499:Hist1h2bg	UTSW	13	23571706	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGTTTCTACCATGCCCGAGC -3'
(R):5'- CAGTATGGGTGGCTCTGAAAAG -3'

Sequencing Primer
(F):5'- TCCAAGAAGGCCGTGACC -3'
(R):5'- CTCTGAAAAGAGCCTTTGGGTTAG -3'

Posted On

2019-06-07