Incidental Mutation 'PIT4508001:Mxd3'
ID556238
Institutional Source Beutler Lab
Gene Symbol Mxd3
Ensembl Gene ENSMUSG00000021485
Gene NameMax dimerization protein 3
Synonyms4631412E13Rik, bHLHc13, Mad3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #PIT4508001 (G1)
Quality Score136.008
Status Not validated
Chromosome13
Chromosomal Location55325168-55329823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55325894 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000021941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021941] [ENSMUST00000021942] [ENSMUST00000035242]
Predicted Effect probably benign
Transcript: ENSMUST00000021941
AA Change: D170E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021941
Gene: ENSMUSG00000021485
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
HLH 63 115 5.8e-11 SMART
low complexity region 119 138 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021942
SMART Domains Protein: ENSMUSP00000021942
Gene: ENSMUSG00000021486

DomainStartEndE-ValueType
Pfam:PRELI 16 172 1.9e-61 PFAM
coiled coil region 178 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035242
SMART Domains Protein: ENSMUSP00000046188
Gene: ENSMUSG00000034789

DomainStartEndE-ValueType
RAB 8 175 2.39e-44 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an essentially normal phenotype. The show an increased sensitivity to gamma irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Mxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Mxd3 APN 13 55329278 missense probably benign 0.01
R0071:Mxd3 UTSW 13 55329636 missense probably damaging 1.00
R4285:Mxd3 UTSW 13 55329354 missense probably benign 0.06
R4683:Mxd3 UTSW 13 55325800 missense probably benign
R5331:Mxd3 UTSW 13 55329258 unclassified probably benign
R6828:Mxd3 UTSW 13 55326154 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTAAGCCAACTTGTGTGGGG -3'
(R):5'- GCTCAAGGAAAAGCTTCGC -3'

Sequencing Primer
(F):5'- TGGGGGCCACTGACTGG -3'
(R):5'- GCTTCGCAGCAAACAGC -3'
Posted On2019-06-07