Incidental Mutation 'PIT4508001:Col4a3bp'
ID556239
Institutional Source Beutler Lab
Gene Symbol Col4a3bp
Ensembl Gene ENSMUSG00000021669
Gene Namecollagen, type IV, alpha 3 (Goodpasture antigen) binding protein
SynonymsGPBP, 2810404O15Rik, Cert, ceramide transport protein, 9230101K08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4508001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96542618-96640167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96630776 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 478 (F478S)
Ref Sequence ENSEMBL: ENSMUSP00000076856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077672] [ENSMUST00000109444] [ENSMUST00000179226]
Predicted Effect probably damaging
Transcript: ENSMUST00000077672
AA Change: F478S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076856
Gene: ENSMUSG00000021669
AA Change: F478S

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 398 619 1.15e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109444
AA Change: F452S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105070
Gene: ENSMUSG00000021669
AA Change: F452S

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179226
AA Change: F452S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136766
Gene: ENSMUSG00000021669
AA Change: F452S

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display embryonic lethality during organogenesis with reduced embryo size, impaired heart function, abnormal heart morphology, abnormal mitochondrial morphology and physiology, abnormal endoplasmic reticulum morphology, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Col4a3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Col4a3bp APN 13 96614802 missense probably damaging 0.99
IGL02121:Col4a3bp APN 13 96599474 missense probably benign 0.45
IGL02207:Col4a3bp APN 13 96624792 critical splice donor site probably null
IGL02285:Col4a3bp APN 13 96616482 missense probably benign 0.10
IGL02425:Col4a3bp APN 13 96609882 missense probably damaging 1.00
IGL02749:Col4a3bp APN 13 96629135 missense possibly damaging 0.60
IGL03288:Col4a3bp APN 13 96634192 missense probably benign 0.00
R0197:Col4a3bp UTSW 13 96549287 missense probably benign 0.05
R0317:Col4a3bp UTSW 13 96634121 nonsense probably null
R2103:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R2104:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R4664:Col4a3bp UTSW 13 96599457 missense probably benign 0.01
R4782:Col4a3bp UTSW 13 96612265 missense probably benign
R4824:Col4a3bp UTSW 13 96616487 missense probably benign
R5060:Col4a3bp UTSW 13 96603155 missense probably benign 0.37
R5131:Col4a3bp UTSW 13 96614835 missense probably damaging 1.00
R5385:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.94
R5503:Col4a3bp UTSW 13 96543239 missense possibly damaging 0.61
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R7193:Col4a3bp UTSW 13 96630833 critical splice donor site probably null
R7819:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.74
R7827:Col4a3bp UTSW 13 96617055 missense probably damaging 1.00
R8147:Col4a3bp UTSW 13 96543228 missense probably benign
R8228:Col4a3bp UTSW 13 96543215 missense probably benign 0.08
R8486:Col4a3bp UTSW 13 96634182 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCAGACCTCACTGTTGCC -3'
(R):5'- CAGGTTGTAATCATCTTCTTTCTCA -3'

Sequencing Primer
(F):5'- AGACCTCACTGTTGCCATCTG -3'
(R):5'- ACATCTGCTACACATATGCTGGGG -3'
Posted On2019-06-07