Incidental Mutation 'PIT4508001:Esco2'
ID556241
Institutional Source Beutler Lab
Gene Symbol Esco2
Ensembl Gene ENSMUSG00000022034
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4508001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65819038-65833994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65831465 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 132 (V132E)
Ref Sequence ENSEMBL: ENSMUSP00000022613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022613] [ENSMUST00000225853]
Predicted Effect probably damaging
Transcript: ENSMUST00000022613
AA Change: V132E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034
AA Change: V132E

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000225853
AA Change: V56E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation associated with impaired chromosome cohesion and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Esco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Esco2 APN 14 65826528 missense probably benign 0.00
IGL01613:Esco2 APN 14 65826595 missense possibly damaging 0.75
IGL02148:Esco2 APN 14 65826595 missense probably benign 0.00
IGL03039:Esco2 APN 14 65831418 missense probably damaging 0.97
R0400:Esco2 UTSW 14 65831706 missense possibly damaging 0.73
R0894:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1778:Esco2 UTSW 14 65831262 missense possibly damaging 0.47
R1795:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1962:Esco2 UTSW 14 65831533 missense probably damaging 1.00
R2325:Esco2 UTSW 14 65826578 splice site probably null
R2357:Esco2 UTSW 14 65826551 missense probably benign 0.32
R2369:Esco2 UTSW 14 65821740 missense probably damaging 1.00
R4659:Esco2 UTSW 14 65826586 missense possibly damaging 0.92
R5648:Esco2 UTSW 14 65831192 missense probably damaging 1.00
R5873:Esco2 UTSW 14 65824191 missense probably benign 0.00
R6782:Esco2 UTSW 14 65820016 missense probably benign 0.00
R6877:Esco2 UTSW 14 65831045 missense probably benign 0.01
R7116:Esco2 UTSW 14 65826557 missense probably damaging 1.00
R7572:Esco2 UTSW 14 65831192 missense probably damaging 0.97
R7645:Esco2 UTSW 14 65827181 missense probably benign 0.08
R8055:Esco2 UTSW 14 65831719 missense probably benign 0.20
R8072:Esco2 UTSW 14 65832681 missense probably benign
R8483:Esco2 UTSW 14 65831669 missense probably benign 0.00
Z1177:Esco2 UTSW 14 65824936 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTTGGTCCACAACTGGC -3'
(R):5'- AGACAAGTCTTGCTCCCACC -3'

Sequencing Primer
(F):5'- GGTCCACAACTGGCTTATAGGTC -3'
(R):5'- AAGTCTTGCTCCCACCAACTC -3'
Posted On2019-06-07