Incidental Mutation 'PIT4508001:Shisa9'
ID556245
Institutional Source Beutler Lab
Gene Symbol Shisa9
Ensembl Gene ENSMUSG00000022494
Gene Nameshisa family member 9
SynonymsCKAMP44, 2700045P11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #PIT4508001 (G1)
Quality Score147.008
Status Not validated
Chromosome16
Chromosomal Location11984113-12270902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12267480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 318 (V318I)
Ref Sequence ENSEMBL: ENSMUSP00000132646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023138] [ENSMUST00000170672]
Predicted Effect probably benign
Transcript: ENSMUST00000023138
AA Change: V302I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023138
Gene: ENSMUSG00000022494
AA Change: V302I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 70 254 7.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170672
AA Change: V318I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132646
Gene: ENSMUSG00000022494
AA Change: V318I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 71 260 2.1e-55 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced AMPA-mediated synaptic currents in retinogeniculate and corticogeniculate synapses, enhanced paired-pulse facilitation in retinogeniculate synapses and decreased synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
H2-Q6 T C 17: 35,425,820 L195P probably damaging Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in Shisa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Shisa9 APN 16 12244658 missense probably benign 0.04
IGL02011:Shisa9 APN 16 12244638 missense possibly damaging 0.87
IGL02884:Shisa9 APN 16 11997043 splice site probably benign
R0194:Shisa9 UTSW 16 11984954 missense probably damaging 1.00
R0309:Shisa9 UTSW 16 11997123 missense probably damaging 1.00
R0588:Shisa9 UTSW 16 12267774 missense probably damaging 0.99
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1781:Shisa9 UTSW 16 12267657 missense probably benign 0.00
R1818:Shisa9 UTSW 16 12267562 missense probably damaging 0.96
R1943:Shisa9 UTSW 16 12267756 missense probably benign 0.06
R2263:Shisa9 UTSW 16 11984767 missense possibly damaging 0.53
R3742:Shisa9 UTSW 16 12267664 missense probably damaging 1.00
R5068:Shisa9 UTSW 16 12267548 missense possibly damaging 0.48
R5977:Shisa9 UTSW 16 12267428 missense probably benign 0.01
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6487:Shisa9 UTSW 16 12244611 missense probably benign 0.01
R6773:Shisa9 UTSW 16 11985028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCTCTGAACTGTGAGG -3'
(R):5'- TGGGGTCCCAGGTCTTAAAG -3'

Sequencing Primer
(F):5'- CTCTGAACTGTGAGGAGGCCATG -3'
(R):5'- CCCAGGTCTTAAAGTTGGCAG -3'
Posted On2019-06-07