Incidental Mutation 'PIT4508001:H2-Q6'
ID556247
Institutional Source Beutler Lab
Gene Symbol H2-Q6
Ensembl Gene ENSMUSG00000073409
Gene Namehistocompatibility 2, Q region locus 6
Synonyms0610037M15Rik, Qa6, H-2Q6, Qa-6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #PIT4508001 (G1)
Quality Score159.009
Status Not validated
Chromosome17
Chromosomal Location35424850-35430055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35425820 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 195 (L195P)
Ref Sequence ENSEMBL: ENSMUSP00000109511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113879] [ENSMUST00000174699]
Predicted Effect probably damaging
Transcript: ENSMUST00000113879
AA Change: L195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109511
Gene: ENSMUSG00000073409
AA Change: L195P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 2.1e-92 PFAM
IGc1 219 290 7.68e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174699
AA Change: L195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134550
Gene: ENSMUSG00000073409
AA Change: L195P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.1e-93 PFAM
IGc1 219 290 7.68e-23 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.7%
  • 10x: 84.6%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls a lymph node and splenic lymphocyte antigen detected by BALB/cBy anti-ORA1-a tumor antibody. The strain distribution for presence/absence of antigen varies widely among inbred strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,357,378 T1228A probably damaging Het
Actg2 A T 6: 83,513,007 I370N possibly damaging Het
Ankrd36 A G 11: 5,607,137 T330A possibly damaging Het
Atrip C T 9: 109,073,989 A6T possibly damaging Het
Bms1 G A 6: 118,383,806 R1234C probably benign Het
Cacnb2 A T 2: 14,984,419 T487S probably benign Het
Col4a3bp T C 13: 96,630,776 F478S probably damaging Het
Esco2 A T 14: 65,831,465 V132E probably damaging Het
Gjb5 A T 4: 127,356,240 L37Q probably damaging Het
Gm8020 T A 14: 42,502,277 Y24F Het
Hc T C 2: 34,984,804 T1602A probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hist1h2bg CTCGACCATCACGTC CTC 13: 23,571,693 probably benign Het
Itga3 T C 11: 95,055,893 H730R probably benign Het
Kif1a A T 1: 93,046,729 L866Q probably damaging Het
Krt81 A T 15: 101,462,725 L127Q probably damaging Het
Mdn1 T C 4: 32,719,223 I2262T probably damaging Het
Mxd3 A T 13: 55,325,894 D170E probably benign Het
Myh2 A G 11: 67,185,505 M811V probably benign Het
Naa16 A T 14: 79,369,087 D335E probably benign Het
Nkd1 A G 8: 88,522,400 T58A probably benign Het
Ogfrl1 T A 1: 23,370,270 R292* probably null Het
Olfr1136 G A 2: 87,693,715 H56Y probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Pom121l12 A G 11: 14,599,689 R132G possibly damaging Het
Prss46 A G 9: 110,851,416 K210E probably damaging Het
Scn8a T C 15: 101,029,692 Y1351H probably damaging Het
Shisa9 G A 16: 12,267,480 V318I probably benign Het
Slc41a2 T G 10: 83,254,880 H480P probably damaging Het
Slc45a1 C A 4: 150,638,435 A331S probably benign Het
Smg1 A T 7: 118,185,541 F885I unknown Het
Speer4f1 T C 5: 17,480,414 S236P unknown Het
Zfp326 A T 5: 105,914,690 Q475L probably benign Het
Zzef1 T G 11: 72,895,176 V2058G probably benign Het
Other mutations in H2-Q6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:H2-Q6 APN 17 35425176 missense probably benign 0.06
R0499:H2-Q6 UTSW 17 35425203 missense probably damaging 0.98
R2426:H2-Q6 UTSW 17 35424937 missense probably benign 0.06
R3236:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3237:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3810:H2-Q6 UTSW 17 35425781 missense probably damaging 1.00
R3827:H2-Q6 UTSW 17 35425679 missense probably damaging 1.00
R3932:H2-Q6 UTSW 17 35425566 splice site probably benign
R4030:H2-Q6 UTSW 17 35425816 missense probably benign 0.00
R4529:H2-Q6 UTSW 17 35425844 missense probably null 1.00
R4558:H2-Q6 UTSW 17 35428315 missense probably benign 0.00
R5100:H2-Q6 UTSW 17 35425320 missense probably benign 0.00
R5435:H2-Q6 UTSW 17 35425685 missense probably damaging 1.00
R5455:H2-Q6 UTSW 17 35424884 missense unknown
R5724:H2-Q6 UTSW 17 35425652 missense probably damaging 1.00
R6383:H2-Q6 UTSW 17 35428383 critical splice donor site probably null
R6752:H2-Q6 UTSW 17 35428127 missense probably damaging 0.96
R6853:H2-Q6 UTSW 17 35428359 makesense probably null
R7421:H2-Q6 UTSW 17 35425228 missense possibly damaging 0.94
R7558:H2-Q6 UTSW 17 35425619 missense probably benign
R7762:H2-Q6 UTSW 17 35428101 missense probably benign 0.01
X0057:H2-Q6 UTSW 17 35425593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTGGATGTATGGCTG -3'
(R):5'- CACTGTGATGAGGGATCAGG -3'

Sequencing Primer
(F):5'- GTACCTGCAGTTCGCCTATGAAG -3'
(R):5'- CTGTGATGAGGGATCAGGAGACC -3'
Posted On2019-06-07