Incidental Mutation 'PIT4514001:Tgfb1i1'
ID556272
Institutional Source Beutler Lab
Gene Symbol Tgfb1i1
Ensembl Gene ENSMUSG00000030782
Gene Nametransforming growth factor beta 1 induced transcript 1
SynonymsARA55, TSC-5, hic-5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #PIT4514001 (G1)
Quality Score156.008
Status Not validated
Chromosome7
Chromosomal Location128246812-128255699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128249181 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 191 (R191C)
Ref Sequence ENSEMBL: ENSMUSP00000130964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000070656] [ENSMUST00000163609] [ENSMUST00000164710] [ENSMUST00000165667] [ENSMUST00000167965] [ENSMUST00000169919] [ENSMUST00000170115]
Predicted Effect probably benign
Transcript: ENSMUST00000044660
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070656
AA Change: R152C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068529
Gene: ENSMUSG00000030782
AA Change: R152C

DomainStartEndE-ValueType
Pfam:Paxillin 19 183 1.7e-7 PFAM
LIM 210 261 5.18e-22 SMART
LIM 269 320 4.37e-20 SMART
LIM 328 379 3.69e-18 SMART
LIM 387 438 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163609
AA Change: R58C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133134
Gene: ENSMUSG00000030782
AA Change: R58C

DomainStartEndE-ValueType
low complexity region 11 44 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
LIM 116 167 5.18e-22 SMART
LIM 175 226 4.37e-20 SMART
LIM 234 285 3.69e-18 SMART
LIM 293 344 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164710
AA Change: R191C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130964
Gene: ENSMUSG00000030782
AA Change: R191C

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 28 48 N/A INTRINSIC
Pfam:Paxillin 49 178 1.4e-10 PFAM
low complexity region 197 209 N/A INTRINSIC
LIM 249 300 5.18e-22 SMART
LIM 308 359 4.37e-20 SMART
LIM 367 418 3.69e-18 SMART
LIM 426 477 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165667
AA Change: R130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127695
Gene: ENSMUSG00000030782
AA Change: R130C

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 27 37 N/A INTRINSIC
low complexity region 83 116 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
LIM 188 239 5.18e-22 SMART
LIM 247 298 4.37e-20 SMART
LIM 306 357 3.69e-18 SMART
LIM 365 416 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167965
AA Change: R169C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132100
Gene: ENSMUSG00000030782
AA Change: R169C

DomainStartEndE-ValueType
Pfam:Paxillin 34 200 7.3e-8 PFAM
LIM 227 278 5.18e-22 SMART
LIM 286 337 4.37e-20 SMART
LIM 345 396 3.69e-18 SMART
LIM 404 455 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168825
SMART Domains Protein: ENSMUSP00000132685
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
LIM 165 216 5.18e-22 SMART
LIM 224 275 4.37e-20 SMART
LIM 283 334 3.69e-18 SMART
LIM 342 393 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169919
SMART Domains Protein: ENSMUSP00000131705
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 44 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170115
SMART Domains Protein: ENSMUSP00000129958
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 17 112 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal response to wire injury of femoral arteries and increased VSMC apoptosis in response to wire injury or mechanical stress. Mice homozygous for a different knock-out allele show normal platelet integrin function both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Tgfb1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tgfb1i1 APN 7 128252521 missense probably damaging 1.00
IGL01919:Tgfb1i1 APN 7 128248482 splice site probably benign
IGL01996:Tgfb1i1 APN 7 128249292 splice site probably benign
IGL02527:Tgfb1i1 APN 7 128252562 splice site probably benign
IGL02596:Tgfb1i1 APN 7 128248896 start codon destroyed probably null 0.05
IGL03139:Tgfb1i1 APN 7 128249304 missense possibly damaging 0.79
PIT4431001:Tgfb1i1 UTSW 7 128249181 missense probably damaging 1.00
R0114:Tgfb1i1 UTSW 7 128249494 missense probably damaging 1.00
R1833:Tgfb1i1 UTSW 7 128249498 splice site probably benign
R2116:Tgfb1i1 UTSW 7 128252805 missense probably damaging 1.00
R2508:Tgfb1i1 UTSW 7 128248913 unclassified probably null
R4695:Tgfb1i1 UTSW 7 128249176 missense probably damaging 1.00
R4756:Tgfb1i1 UTSW 7 128249399 missense probably damaging 1.00
R4853:Tgfb1i1 UTSW 7 128248668 nonsense probably null
R5024:Tgfb1i1 UTSW 7 128248217 start codon destroyed probably null 0.33
R5770:Tgfb1i1 UTSW 7 128248547 intron probably benign
R5839:Tgfb1i1 UTSW 7 128253365 makesense probably null
R6105:Tgfb1i1 UTSW 7 128248417 splice site probably null
R6178:Tgfb1i1 UTSW 7 128253345 missense probably damaging 0.98
R6310:Tgfb1i1 UTSW 7 128252837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACTGTGTGAGTTTGGTAG -3'
(R):5'- TGGAGATGGGCATCCTTCAC -3'

Sequencing Primer
(F):5'- CTGGGAAGCGGATGATGGGTC -3'
(R):5'- ATCCTTCACGGGTGGGG -3'
Posted On2019-06-07