Incidental Mutation 'PIT4514001:Olfr122'
ID556286
Institutional Source Beutler Lab
Gene Symbol Olfr122
Ensembl Gene ENSMUSG00000083947
Gene Nameolfactory receptor 122
SynonymsMOR263-10, GA_x6K02T2PSCP-2230932-2231897
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37768607-37773749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37771867 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 71 (N71K)
Ref Sequence ENSEMBL: ENSMUSP00000134283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119082] [ENSMUST00000172582] [ENSMUST00000217119]
Predicted Effect probably damaging
Transcript: ENSMUST00000119082
AA Change: N80K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113170
Gene: ENSMUSG00000083947
AA Change: N80K

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 50 320 2.7e-6 PFAM
Pfam:7tm_1 56 305 3.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172582
AA Change: N71K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134283
Gene: ENSMUSG00000083947
AA Change: N71K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 311 9.5e-8 PFAM
Pfam:7tm_1 47 296 7.8e-36 PFAM
Pfam:7tm_4 145 289 1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217119
AA Change: N71K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Olfr122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Olfr122 APN 17 37772614 missense probably benign 0.00
IGL01338:Olfr122 APN 17 37771839 missense possibly damaging 0.90
IGL01447:Olfr122 APN 17 37772231 missense probably damaging 1.00
R0402:Olfr122 UTSW 17 37772393 missense probably damaging 1.00
R0830:Olfr122 UTSW 17 37771913 missense probably damaging 0.99
R2018:Olfr122 UTSW 17 37772576 missense probably benign 0.00
R4258:Olfr122 UTSW 17 37772058 missense probably damaging 1.00
R6371:Olfr122 UTSW 17 37772435 missense probably benign
R6481:Olfr122 UTSW 17 37772303 missense probably damaging 1.00
R7468:Olfr122 UTSW 17 37772019 missense probably damaging 1.00
R7492:Olfr122 UTSW 17 37771680 missense possibly damaging 0.53
R8114:Olfr122 UTSW 17 37771989 missense possibly damaging 0.67
R8172:Olfr122 UTSW 17 37772435 missense probably benign
R8728:Olfr122 UTSW 17 37771751 missense probably damaging 1.00
R8894:Olfr122 UTSW 17 37772049 missense probably damaging 1.00
Z1177:Olfr122 UTSW 17 37772191 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTATCAACTGCTCTCTGTGGC -3'
(R):5'- GGGAGCATATGGCCATGTAG -3'

Sequencing Primer
(F):5'- CTCTCTGTGGCAGGAGAACAG -3'
(R):5'- AGCATATGGCCATGTAGCGGTC -3'
Posted On2019-06-07