Incidental Mutation 'R0605:Olfr1097'
ID55629
Institutional Source Beutler Lab
Gene Symbol Olfr1097
Ensembl Gene ENSMUSG00000075170
Gene Nameolfactory receptor 1097
SynonymsMOR206-2, GA_x6K02T2Q125-48376288-48375341
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86886773-86892216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86890419 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 252 (Y252C)
Ref Sequence ENSEMBL: ENSMUSP00000150400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111576] [ENSMUST00000217403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111576
AA Change: Y252C

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107202
Gene: ENSMUSG00000075170
AA Change: Y252C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 312 4.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217403
AA Change: Y252C

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.3690 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Als2 A G 1: 59,168,414 L1528S probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mdm1 C T 10: 118,146,601 T47M probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Phlpp2 A G 8: 109,933,211 N721S probably benign Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Plppr1 A T 4: 49,323,466 N252I probably damaging Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prom2 C A 2: 127,539,995 probably null Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vps8 A T 16: 21,559,337 T1033S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Olfr1097
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1097 APN 2 86890245 missense probably benign
IGL01674:Olfr1097 APN 2 86890749 missense probably benign
IGL02089:Olfr1097 APN 2 86891116 missense possibly damaging 0.86
IGL02201:Olfr1097 APN 2 86891076 missense probably damaging 0.97
IGL02426:Olfr1097 APN 2 86890620 missense probably damaging 1.00
IGL02469:Olfr1097 APN 2 86891155 missense possibly damaging 0.91
IGL02489:Olfr1097 APN 2 86890995 missense probably damaging 1.00
IGL02817:Olfr1097 APN 2 86890593 missense probably benign
R0042:Olfr1097 UTSW 2 86890491 missense probably damaging 1.00
R1867:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R2412:Olfr1097 UTSW 2 86890834 missense probably benign 0.01
R4465:Olfr1097 UTSW 2 86891150 missense probably benign
R4520:Olfr1097 UTSW 2 86891019 missense probably benign 0.20
R5185:Olfr1097 UTSW 2 86890602 missense probably benign 0.42
R5329:Olfr1097 UTSW 2 86890620 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890314 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890315 missense probably damaging 1.00
R5847:Olfr1097 UTSW 2 86890332 missense probably damaging 0.99
R6288:Olfr1097 UTSW 2 86890882 missense probably benign 0.01
R6906:Olfr1097 UTSW 2 86890747 missense probably benign
R7161:Olfr1097 UTSW 2 86890649 missense probably benign 0.01
R7256:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R7404:Olfr1097 UTSW 2 86890873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTCTGTCAGTTTTGTGCCAAGAGAG -3'
(R):5'- TGCAGTGATACCTATAATGCAGAAGCC -3'

Sequencing Primer
(F):5'- TTTTGTGCCAAGAGAGAAGCTG -3'
(R):5'- GCAGAAGCCACTATATTCGTTTTAGC -3'
Posted On2013-07-11