Incidental Mutation 'PIT4515001:Col4a3'
ID556291
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Namecollagen, type IV, alpha 3
Synonymsalpha3(IV), tumstatin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4515001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location82586921-82722059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82682303 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 890 (G890R)
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
Predicted Effect unknown
Transcript: ENSMUST00000113457
AA Change: G890R
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: G890R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 intron probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 intron probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R8127:Col4a3 UTSW 1 82649760 missense unknown
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCACTCTGTTGTCAACCAC -3'
(R):5'- AATGCATTCTTCACTGACAACC -3'

Sequencing Primer
(F):5'- CTGTTGTCAACCACAGTGTTATTTG -3'
(R):5'- GTGAACGCTATCCATACCT -3'
Posted On2019-06-07