Incidental Mutation 'PIT4515001:Tle1'
ID556296
Institutional Source Beutler Lab
Gene Symbol Tle1
Ensembl Gene ENSMUSG00000008305
Gene Nametransducin-like enhancer of split 1
SynonymsC230057C06Rik, Estm14, Grg1, Tle4l
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #PIT4515001 (G1)
Quality Score91.0077
Status Not validated
Chromosome4
Chromosomal Location72117142-72200919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72199319 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 35 (F35I)
Ref Sequence ENSEMBL: ENSMUSP00000102960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030095] [ENSMUST00000072695] [ENSMUST00000074216] [ENSMUST00000102848] [ENSMUST00000107337] [ENSMUST00000137075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030095
AA Change: F35I

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030095
Gene: ENSMUSG00000008305
AA Change: F35I

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 9.1e-77 PFAM
low complexity region 155 183 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
WD40 484 521 4.18e-2 SMART
WD40 527 568 1.03e-1 SMART
WD40 573 612 9.38e-5 SMART
WD40 615 654 1.14e-8 SMART
WD40 657 695 3.07e1 SMART
WD40 697 736 8.96e-2 SMART
WD40 737 777 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072695
AA Change: F35I

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072481
Gene: ENSMUSG00000008305
AA Change: F35I

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.6e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074216
AA Change: F35I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073839
Gene: ENSMUSG00000008305
AA Change: F35I

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 1.3e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102848
AA Change: F43I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099912
Gene: ENSMUSG00000008305
AA Change: F43I

DomainStartEndE-ValueType
Pfam:TLE_N 1 144 1.3e-76 PFAM
low complexity region 153 181 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 290 312 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
WD40 481 518 4.18e-2 SMART
WD40 524 565 1.03e-1 SMART
WD40 570 609 9.38e-5 SMART
WD40 612 651 1.14e-8 SMART
WD40 654 692 3.07e1 SMART
WD40 694 733 8.96e-2 SMART
WD40 734 774 4.14e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107337
AA Change: F35I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102960
Gene: ENSMUSG00000008305
AA Change: F35I

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 7.2e-80 PFAM
low complexity region 145 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134225
Predicted Effect possibly damaging
Transcript: ENSMUST00000137075
AA Change: F57I

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118683
Gene: ENSMUSG00000008305
AA Change: F57I

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:TLE_N 22 158 4.2e-77 PFAM
low complexity region 167 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Tle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tle1 APN 4 72169118 missense possibly damaging 0.94
IGL00972:Tle1 APN 4 72122400 missense probably damaging 1.00
IGL01548:Tle1 APN 4 72170718 missense probably damaging 1.00
IGL01737:Tle1 APN 4 72197821 splice site probably benign
IGL01798:Tle1 APN 4 72137148 missense probably damaging 1.00
IGL01943:Tle1 APN 4 72122402 missense probably damaging 1.00
BB006:Tle1 UTSW 4 72200002 missense possibly damaging 0.50
BB016:Tle1 UTSW 4 72200002 missense possibly damaging 0.50
R0140:Tle1 UTSW 4 72120185 missense probably damaging 1.00
R0544:Tle1 UTSW 4 72124990 missense probably damaging 1.00
R0603:Tle1 UTSW 4 72118347 missense probably damaging 1.00
R0729:Tle1 UTSW 4 72126442 splice site probably benign
R0786:Tle1 UTSW 4 72199361 missense probably damaging 1.00
R0939:Tle1 UTSW 4 72118534 missense probably damaging 1.00
R1297:Tle1 UTSW 4 72124838 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1512:Tle1 UTSW 4 72141258 missense probably damaging 1.00
R1967:Tle1 UTSW 4 72120226 missense probably damaging 1.00
R2218:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R3713:Tle1 UTSW 4 72126422 missense possibly damaging 0.70
R4367:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4379:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4380:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4655:Tle1 UTSW 4 72145344 missense possibly damaging 0.68
R4662:Tle1 UTSW 4 72137098 missense possibly damaging 0.92
R4731:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4732:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4733:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4812:Tle1 UTSW 4 72145354 missense probably damaging 0.98
R5066:Tle1 UTSW 4 72158267 missense probably benign 0.24
R5288:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5386:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5405:Tle1 UTSW 4 72138971 intron probably benign
R5579:Tle1 UTSW 4 72139808 missense probably damaging 1.00
R5590:Tle1 UTSW 4 72124971 missense possibly damaging 0.91
R5762:Tle1 UTSW 4 72120135 splice site probably null
R6617:Tle1 UTSW 4 72141280 missense probably damaging 0.98
R6750:Tle1 UTSW 4 72122450 missense probably damaging 1.00
R7077:Tle1 UTSW 4 72158375 missense probably benign 0.25
R7153:Tle1 UTSW 4 72139061 missense probably benign 0.03
R7156:Tle1 UTSW 4 72170716 missense probably benign 0.15
R7266:Tle1 UTSW 4 72139687 critical splice donor site probably null
R7316:Tle1 UTSW 4 72118292 missense probably benign 0.01
R7478:Tle1 UTSW 4 72137112 missense probably damaging 0.96
R7523:Tle1 UTSW 4 72145418 missense possibly damaging 0.94
R7736:Tle1 UTSW 4 72199334 missense probably damaging 1.00
R7862:Tle1 UTSW 4 72199315 missense probably damaging 1.00
R7863:Tle1 UTSW 4 72141292 missense probably null 0.68
R7929:Tle1 UTSW 4 72200002 missense possibly damaging 0.50
R8074:Tle1 UTSW 4 72138979 frame shift probably null
R8233:Tle1 UTSW 4 72124944 missense probably benign 0.11
R8315:Tle1 UTSW 4 72126191 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGAATGACAGGGCTTAACG -3'
(R):5'- CCTCTCTAAAGTGAACCGAGG -3'

Sequencing Primer
(F):5'- TGACAGGGCTTAACGGTGACTC -3'
(R):5'- AACCGAGGGTTCTAGTTTGGGC -3'
Posted On2019-06-07