Incidental Mutation 'PIT4515001:Ccdc136'
ID556308
Institutional Source Beutler Lab
Gene Symbol Ccdc136
Ensembl Gene ENSMUSG00000029769
Gene Namecoiled-coil domain containing 136
Synonyms4921511K06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4515001 (G1)
Quality Score146.008
Status Not validated
Chromosome6
Chromosomal Location29396309-29426994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29417226 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 682 (V682E)
Ref Sequence ENSEMBL: ENSMUSP00000137673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096084] [ENSMUST00000115275] [ENSMUST00000145310] [ENSMUST00000154619] [ENSMUST00000180829] [ENSMUST00000181464] [ENSMUST00000202726]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096084
AA Change: V774E

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093789
Gene: ENSMUSG00000029769
AA Change: V774E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 7.26e-6 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 8.87e-9 PROSPERO
internal_repeat_1 819 838 8.87e-9 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 7.26e-6 PROSPERO
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
coiled coil region 1066 1104 N/A INTRINSIC
low complexity region 1108 1142 N/A INTRINSIC
transmembrane domain 1154 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115275
AA Change: V774E

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110930
Gene: ENSMUSG00000029769
AA Change: V774E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 1.72e-5 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 2.93e-8 PROSPERO
internal_repeat_1 819 838 2.93e-8 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 1.72e-5 PROSPERO
transmembrane domain 967 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145310
SMART Domains Protein: ENSMUSP00000145331
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154619
AA Change: V616E

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118132
Gene: ENSMUSG00000029769
AA Change: V616E

DomainStartEndE-ValueType
coiled coil region 1 152 N/A INTRINSIC
coiled coil region 185 250 N/A INTRINSIC
internal_repeat_2 258 277 4.68e-6 PROSPERO
low complexity region 281 295 N/A INTRINSIC
coiled coil region 305 331 N/A INTRINSIC
coiled coil region 368 453 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
coiled coil region 572 621 N/A INTRINSIC
internal_repeat_1 633 652 5.47e-9 PROSPERO
internal_repeat_1 661 680 5.47e-9 PROSPERO
low complexity region 689 710 N/A INTRINSIC
internal_repeat_2 744 763 4.68e-6 PROSPERO
low complexity region 836 853 N/A INTRINSIC
low complexity region 865 883 N/A INTRINSIC
coiled coil region 908 946 N/A INTRINSIC
low complexity region 950 984 N/A INTRINSIC
transmembrane domain 996 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180829
AA Change: V682E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137747
Gene: ENSMUSG00000029769
AA Change: V682E

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 1.21e-5 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.98e-8 PROSPERO
internal_repeat_1 727 746 1.98e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 1.21e-5 PROSPERO
transmembrane domain 875 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181464
AA Change: V682E

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137673
Gene: ENSMUSG00000029769
AA Change: V682E

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 7.68e-6 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.04e-8 PROSPERO
internal_repeat_1 727 746 1.04e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 7.68e-6 PROSPERO
low complexity region 902 919 N/A INTRINSIC
low complexity region 931 949 N/A INTRINSIC
transmembrane domain 969 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202726
SMART Domains Protein: ENSMUSP00000144577
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
coiled coil region 25 90 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Ccdc136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ccdc136 APN 6 29420258 missense probably damaging 0.96
IGL01325:Ccdc136 APN 6 29412950 missense probably benign 0.00
IGL01608:Ccdc136 APN 6 29406114 missense possibly damaging 0.90
IGL02305:Ccdc136 APN 6 29406174 missense probably damaging 1.00
IGL03354:Ccdc136 APN 6 29419103 missense probably damaging 1.00
R0436:Ccdc136 UTSW 6 29414934 missense probably damaging 1.00
R0709:Ccdc136 UTSW 6 29414970 missense possibly damaging 0.64
R1451:Ccdc136 UTSW 6 29419377 missense probably benign 0.09
R1593:Ccdc136 UTSW 6 29415584 missense probably damaging 1.00
R1966:Ccdc136 UTSW 6 29418092 missense probably damaging 1.00
R2113:Ccdc136 UTSW 6 29413032 missense possibly damaging 0.51
R3845:Ccdc136 UTSW 6 29417177 missense probably benign 0.20
R4668:Ccdc136 UTSW 6 29411281 missense probably damaging 0.99
R5037:Ccdc136 UTSW 6 29417123 missense probably damaging 1.00
R5085:Ccdc136 UTSW 6 29419314 missense probably damaging 1.00
R5314:Ccdc136 UTSW 6 29417498 missense probably benign 0.07
R5340:Ccdc136 UTSW 6 29411860 missense possibly damaging 0.84
R5702:Ccdc136 UTSW 6 29412982 missense probably damaging 0.99
R6108:Ccdc136 UTSW 6 29412450 missense probably benign 0.03
R6313:Ccdc136 UTSW 6 29410205 missense probably damaging 0.99
R6640:Ccdc136 UTSW 6 29412960 missense possibly damaging 0.95
R6765:Ccdc136 UTSW 6 29405941 missense probably benign
R7910:Ccdc136 UTSW 6 29420034 missense probably benign 0.08
R8030:Ccdc136 UTSW 6 29417142 missense probably benign 0.07
X0025:Ccdc136 UTSW 6 29409243 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GTAATGGTGATGTCTCCTGCCC -3'
(R):5'- CTTCTCAAAGGCCTCGTTGG -3'

Sequencing Primer
(F):5'- GATGTCTCCTGCCCCCTGC -3'
(R):5'- CTACTGTCATAGCTCTTGAGGAAG -3'
Posted On2019-06-07