Incidental Mutation 'R0605:Prom2'
ID55631
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Nameprominin 2
Synonyms
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127526473-127541467 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 127539995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000028855] [ENSMUST00000103214] [ENSMUST00000103214]
Predicted Effect probably null
Transcript: ENSMUST00000028855
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028855
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103214
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103214
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155581
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Als2 A G 1: 59,168,414 L1528S probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mdm1 C T 10: 118,146,601 T47M probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1097 T C 2: 86,890,419 Y252C possibly damaging Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Phlpp2 A G 8: 109,933,211 N721S probably benign Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Plppr1 A T 4: 49,323,466 N252I probably damaging Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vps8 A T 16: 21,559,337 T1033S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127541139 missense probably benign 0.04
IGL01140:Prom2 APN 2 127531205 splice site probably benign
IGL01300:Prom2 APN 2 127535089 missense probably benign 0.44
IGL01445:Prom2 APN 2 127539513 splice site probably benign
IGL01472:Prom2 APN 2 127532882 missense probably benign 0.39
IGL01541:Prom2 APN 2 127529130 critical splice donor site probably null
IGL01991:Prom2 APN 2 127529222 missense probably damaging 1.00
IGL02421:Prom2 APN 2 127531882 critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127529471 missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127538657 splice site probably benign
IGL02826:Prom2 APN 2 127531116 missense probably benign 0.07
IGL02830:Prom2 APN 2 127535069 missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127528814 missense probably benign 0.10
R0110:Prom2 UTSW 2 127531113 missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127538338 splice site probably benign
R0165:Prom2 UTSW 2 127539514 splice site probably benign
R0220:Prom2 UTSW 2 127541107 missense probably benign 0.03
R0466:Prom2 UTSW 2 127528789 missense probably damaging 0.99
R0505:Prom2 UTSW 2 127532867 missense possibly damaging 0.82
R0633:Prom2 UTSW 2 127539525 missense probably benign 0.19
R0947:Prom2 UTSW 2 127538263 missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127540162 missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127532882 missense probably damaging 1.00
R1859:Prom2 UTSW 2 127541097 missense probably damaging 0.97
R1864:Prom2 UTSW 2 127539787 missense probably benign 0.00
R1866:Prom2 UTSW 2 127536594 missense probably damaging 0.99
R3824:Prom2 UTSW 2 127535673 splice site probably benign
R4472:Prom2 UTSW 2 127540191 missense probably benign 0.06
R5078:Prom2 UTSW 2 127531837 missense probably benign 0.00
R5889:Prom2 UTSW 2 127529411 missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127530133 nonsense probably null
R6214:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6215:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6914:Prom2 UTSW 2 127530375 missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127539778 missense probably benign
R7427:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7428:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7525:Prom2 UTSW 2 127532781 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCAGGGACATCAGAGACCAGG -3'
(R):5'- TGGTTCGATATGAGGCAGGCTACG -3'

Sequencing Primer
(F):5'- CTCTTAGGCTGAGCAGGGTC -3'
(R):5'- TGTGATTGCTGGCCTCTAC -3'
Posted On2013-07-11