Incidental Mutation 'PIT4515001:Vmn1r173'
ID556314
Institutional Source Beutler Lab
Gene Symbol Vmn1r173
Ensembl Gene ENSMUSG00000115021
Gene Namevomeronasal 1 receptor 173
SynonymsGm5892
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #PIT4515001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23700703-23711009 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 23702486 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 49 (R49*)
Ref Sequence ENSEMBL: ENSMUSP00000134645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174055] [ENSMUST00000226233] [ENSMUST00000227987]
Predicted Effect probably null
Transcript: ENSMUST00000174055
AA Change: R49*
SMART Domains Protein: ENSMUSP00000134645
Gene: ENSMUSG00000115021
AA Change: R49*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:V1R 43 301 5.3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226233
AA Change: R49*
Predicted Effect probably null
Transcript: ENSMUST00000227987
AA Change: R49*
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Vmn1r173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Vmn1r173 APN 7 23702707 missense probably benign 0.01
IGL01637:Vmn1r173 APN 7 23702948 missense probably damaging 0.96
IGL01878:Vmn1r173 APN 7 23702452 missense probably damaging 1.00
IGL02036:Vmn1r173 APN 7 23702896 missense probably benign 0.04
IGL02039:Vmn1r173 APN 7 23702896 missense probably benign 0.04
IGL02171:Vmn1r173 APN 7 23702896 missense probably benign 0.04
IGL02209:Vmn1r173 APN 7 23703161 missense probably benign 0.25
R0157:Vmn1r173 UTSW 7 23702397 missense probably damaging 0.99
R0226:Vmn1r173 UTSW 7 23703083 missense possibly damaging 0.65
R0482:Vmn1r173 UTSW 7 23702791 missense probably damaging 0.99
R0792:Vmn1r173 UTSW 7 23702735 missense probably benign 0.01
R1242:Vmn1r173 UTSW 7 23703225 missense probably damaging 1.00
R1390:Vmn1r173 UTSW 7 23702898 missense possibly damaging 0.82
R1641:Vmn1r173 UTSW 7 23703108 missense probably benign 0.06
R1867:Vmn1r173 UTSW 7 23703235 missense unknown
R2325:Vmn1r173 UTSW 7 23703112 nonsense probably null
R3863:Vmn1r173 UTSW 7 23702552 missense probably damaging 1.00
R4407:Vmn1r173 UTSW 7 23703016 missense probably damaging 1.00
R4717:Vmn1r173 UTSW 7 23703212 missense probably damaging 1.00
R4841:Vmn1r173 UTSW 7 23702936 missense probably damaging 1.00
R4842:Vmn1r173 UTSW 7 23702936 missense probably damaging 1.00
R5966:Vmn1r173 UTSW 7 23702687 missense probably benign 0.00
R6022:Vmn1r173 UTSW 7 23702835 missense probably benign 0.07
R6114:Vmn1r173 UTSW 7 23702829 missense possibly damaging 0.53
R6657:Vmn1r173 UTSW 7 23702895 missense probably damaging 0.98
R7165:Vmn1r173 UTSW 7 23702651 missense probably benign 0.00
R7195:Vmn1r173 UTSW 7 23702459 missense probably damaging 0.99
R7201:Vmn1r173 UTSW 7 23702158 start gained probably benign
R7533:Vmn1r173 UTSW 7 23702646 missense probably benign 0.05
X0022:Vmn1r173 UTSW 7 23702587 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACAGTGGTGTCTTCTTACTCAG -3'
(R):5'- CATGTTTGCACTTCGAGCCAC -3'

Sequencing Primer
(F):5'- GGTGTCTTCTTACTCAGGAAAATAC -3'
(R):5'- TTCGAGCCACCAGACGAATG -3'
Posted On2019-06-07