Incidental Mutation 'PIT4515001:Olfr741'
ID556338
Institutional Source Beutler Lab
Gene Symbol Olfr741
Ensembl Gene ENSMUSG00000095765
Gene Nameolfactory receptor 741
SynonymsMOR106-15, MOR106-10, GA_x6K02T2PMLR-6197851-6198786
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #PIT4515001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50472738-50488338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50486079 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 207 (M207K)
Ref Sequence ENSEMBL: ENSMUSP00000145848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071932] [ENSMUST00000205518] [ENSMUST00000213903]
Predicted Effect probably benign
Transcript: ENSMUST00000071932
AA Change: M207K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071824
Gene: ENSMUSG00000095765
AA Change: M207K

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.2e-55 PFAM
Pfam:7tm_1 45 294 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205518
AA Change: M207K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213903
AA Change: M207K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Olfr741
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr741 APN 14 50485773 missense probably damaging 0.98
IGL01796:Olfr741 APN 14 50485541 missense probably benign 0.28
IGL01916:Olfr741 APN 14 50485493 missense probably benign 0.01
IGL02686:Olfr741 APN 14 50485969 missense probably benign 0.01
IGL02874:Olfr741 APN 14 50486229 missense possibly damaging 0.57
IGL02898:Olfr741 APN 14 50486186 missense probably damaging 1.00
R0085:Olfr741 UTSW 14 50486334 missense probably benign 0.16
R1777:Olfr741 UTSW 14 50486300 missense probably benign 0.08
R1850:Olfr741 UTSW 14 50485598 missense probably benign
R2270:Olfr741 UTSW 14 50486037 missense probably damaging 1.00
R2338:Olfr741 UTSW 14 50485640 missense possibly damaging 0.47
R2971:Olfr741 UTSW 14 50485608 missense probably damaging 0.99
R4594:Olfr741 UTSW 14 50486162 missense probably benign 0.00
R5383:Olfr741 UTSW 14 50486052 nonsense probably null
R5708:Olfr741 UTSW 14 50485995 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R7116:Olfr741 UTSW 14 50485568 missense probably benign 0.00
R7702:Olfr741 UTSW 14 50486294 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACACCCTTGTGACCAGTTG -3'
(R):5'- GTTACAAGCTTCTGCATTCCGG -3'

Sequencing Primer
(F):5'- GCTGGGTGCTTGGTTTCCTC -3'
(R):5'- CTCAGATGTTGGGCTCAGATAC -3'
Posted On2019-06-07