Incidental Mutation 'PIT4515001:Iglc1'
ID556344
Institutional Source Beutler Lab
Gene Symbol Iglc1
Ensembl Gene ENSMUSG00000105906
Gene Nameimmunoglobulin lambda constant 1
SynonymsClambda1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #PIT4515001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location19061752-19062071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19061951 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 40 (D40A)
Predicted Effect probably benign
Transcript: ENSMUST00000199490
Predicted Effect probably benign
Transcript: ENSMUST00000200074
Predicted Effect probably benign
Transcript: ENSMUST00000200235
Predicted Effect
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Knock-in mice homozygous for a PGK-neo insertion and a serine codon mutation show altered kappa and lambda B cell number. Knock-in mice heterozygous for the same PGK-neo insertion and a valine mutation show abnormal immunoglobulin light chain V-J joiningwhile homozygotes show reduced B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Iglc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2860:Iglc1 UTSW 16 19061910 unclassified probably benign
R2861:Iglc1 UTSW 16 19061910 unclassified probably benign
R2862:Iglc1 UTSW 16 19061910 unclassified probably benign
R4382:Iglc1 UTSW 16 19061758 nonsense probably null
R4385:Iglc1 UTSW 16 19061758 nonsense probably null
R5884:Iglc1 UTSW 16 19061991 unclassified probably benign
R6802:Iglc1 UTSW 16 19061910 unclassified probably benign
R6882:Iglc1 UTSW 16 19061849 unclassified probably benign
R7623:Iglc1 UTSW 16 19061801 missense
Predicted Primers PCR Primer
(F):5'- TGACCTAGGAACAGTCAGCACG -3'
(R):5'- AGGACACTTTACACACTGCC -3'

Sequencing Primer
(F):5'- GGACAAACTCTTCTCCACAGTGTG -3'
(R):5'- TGCCTCCAGGATTGCTACTGAAAG -3'
Posted On2019-06-07