Incidental Mutation 'PIT4515001:Hlcs'
ID556347
Institutional Source Beutler Lab
Gene Symbol Hlcs
Ensembl Gene ENSMUSG00000040820
Gene Nameholocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
SynonymsD16Jhu34, 410I21.SP6
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4515001 (G1)
Quality Score156.008
Status Not validated
Chromosome16
Chromosomal Location94128882-94313571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94267416 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 315 (V315E)
Ref Sequence ENSEMBL: ENSMUSP00000130981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141]
Predicted Effect probably benign
Transcript: ENSMUST00000099512
AA Change: V315E

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: V315E

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 1.9e-21 PFAM
Pfam:BPL_C 665 714 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163193
AA Change: V315E

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: V315E

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 3.6e-30 PFAM
Pfam:BPL_C 665 714 4.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227141
AA Change: V462E

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Hlcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Hlcs APN 16 94133160 missense probably damaging 0.99
IGL02026:Hlcs APN 16 94134705 missense probably damaging 0.99
IGL02341:Hlcs APN 16 94231110 missense probably damaging 0.99
IGL03075:Hlcs APN 16 94138847 missense probably damaging 1.00
R0372:Hlcs UTSW 16 94138907 missense possibly damaging 0.69
R0664:Hlcs UTSW 16 94231311 missense probably damaging 1.00
R0731:Hlcs UTSW 16 94131852 missense probably damaging 1.00
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1761:Hlcs UTSW 16 94268007 missense probably benign 0.05
R2013:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2014:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2015:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2204:Hlcs UTSW 16 94231152 missense probably benign 0.30
R2371:Hlcs UTSW 16 94268067 missense probably damaging 0.98
R3816:Hlcs UTSW 16 94133088 missense probably benign 0.11
R3822:Hlcs UTSW 16 94267981 missense probably benign 0.04
R4422:Hlcs UTSW 16 94138960 missense possibly damaging 0.56
R4657:Hlcs UTSW 16 94262698 missense probably benign 0.00
R4783:Hlcs UTSW 16 94268539 missense possibly damaging 0.82
R5347:Hlcs UTSW 16 94267524 missense possibly damaging 0.93
R5808:Hlcs UTSW 16 94262632 missense probably benign 0.00
R5940:Hlcs UTSW 16 94134712 missense probably damaging 0.99
R6341:Hlcs UTSW 16 94231163 missense probably damaging 1.00
R6943:Hlcs UTSW 16 94141402 missense possibly damaging 0.75
R7053:Hlcs UTSW 16 94268015 missense possibly damaging 0.91
R7157:Hlcs UTSW 16 94268164 nonsense probably null
R7166:Hlcs UTSW 16 94262726 missense possibly damaging 0.92
R7313:Hlcs UTSW 16 94267503 missense probably damaging 1.00
R7427:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7428:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7547:Hlcs UTSW 16 94231172 nonsense probably null
R7548:Hlcs UTSW 16 94133017 nonsense probably null
R8172:Hlcs UTSW 16 94267626 missense probably damaging 1.00
R8241:Hlcs UTSW 16 94267818 missense probably damaging 1.00
X0065:Hlcs UTSW 16 94133173 missense probably damaging 1.00
Z1176:Hlcs UTSW 16 94262659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCATGCTTGAAAGGCAAAC -3'
(R):5'- CTATCTTTCTCAGGGAGGGAAG -3'

Sequencing Primer
(F):5'- GCTTGAAAGGCAAACACTTTG -3'
(R):5'- AAGGTGCTGGGCCTGTC -3'
Posted On2019-06-07